Skip to content

Term: adapters (adapters)

Adapters provide priming sequences for both amplification and sequencing of the sample-library fragments. Both adapters should be reported; in uppercase letters

URI: MIXS:0000048

Applicable Checklists and Extensions

NOTE: does not include Combinations (of checklists and extensions) that use adapters.

Name Description Checklist/Extension
MimsMisip Metagenome or Environmental with SIP Checklist
MigsBa Minimal Information about a Genome Sequence: cultured bacteria/archaea Checklist
MigsEu Minimal Information about a Genome Sequence: eukaryote Checklist
MigsOrg Minimal Information about a Genome Sequence: organelle Checklist
MigsPl Minimal Information about a Genome Sequence: plasmid Checklist
MigsVi Minimal Information about a Genome Sequence: virus Checklist
Mimag Minimum Information About a Metagenome-Assembled Genome Checklist
MimarksS Minimal Information about a Marker Sequence: survey Checklist
Mims Metagenome or Environmental Checklist
Misag Minimum Information About a Single Amplified Genome Checklist
Miuvig Minimum Information About an Uncultivated Virus Genome Checklist
Agriculture A collection of terms appropriate when sequencing samples obtained in an agri... Extension
MimsHostAssociatedAncient MIxS Data that comply with the Mims checklist, and HostAssociated and Ancient... -
MimsHumanAssociatedAncient MIxS Data that comply with the Mims checklist, and HumanAssociated and Ancien... -
MimsHumanOralAncient MIxS Data that comply with the Mims checklist, and HumanOral and Ancient exte... -
MimsHumanGutAncient MIxS Data that comply with the Mims checklist, and HumanGut and Ancient exten... -
MimsHumanSkinAncient MIxS Data that comply with the Mims checklist, and HumanSkin and Ancient exte... -
MimsSedimentAncient MIxS Data that comply with the Mims checklist, and Sediment and Ancient exten... -
MimsSoilAncient MIxS Data that comply with the Mims checklist, and Soil and Ancient extension... -
MimsPlantAssociatedAncient MIxS Data that comply with the Mims checklist, and PlantAssociated and Ancien... -

Properties

  • Range: String
  • Cardinality: 0..1

  • Structured pattern: ^{dna_bases};{dna_bases}$

Examples

Value
AATGATACGGCGACCACCGAGATCTACACGCT;CAAGCAGAAGACGGCATACGAGAT

LinkML Source

name: adapters
description: Adapters provide priming sequences for both amplification and sequencing
  of the sample-library fragments. Both adapters should be reported; in uppercase
  letters
title: adapters
examples:
- value: AATGATACGGCGACCACCGAGATCTACACGCT;CAAGCAGAAGACGGCATACGAGAT
in_subset:
- sequencing
from_schema: https://w3id.org/mixs
slot_uri: MIXS:0000048
domain_of:
- MimsMisip
- MigsBa
- MigsEu
- MigsOrg
- MigsPl
- MigsVi
- Mimag
- MimarksS
- Mims
- Misag
- Miuvig
- Agriculture
- MimsHostAssociatedAncient
- MimsHumanAssociatedAncient
- MimsHumanOralAncient
- MimsHumanGutAncient
- MimsHumanSkinAncient
- MimsSedimentAncient
- MimsSoilAncient
- MimsPlantAssociatedAncient
range: string
structured_pattern:
  syntax: ^{dna_bases};{dna_bases}$
  interpolated: true
  partial_match: true