Term: adapters (adapters)
Adapters provide priming sequences for both amplification and sequencing of the sample-library fragments. Both adapters should be reported; in uppercase letters
URI: MIXS:0000048
Applicable Checklists and Extensions
NOTE: does not include Combinations (of checklists and extensions) that use adapters.
| Name | Description | Checklist/Extension |
|---|---|---|
| MimsMisip | Metagenome or Environmental with SIP | Checklist |
| MigsBa | Minimal Information about a Genome Sequence: cultured bacteria/archaea | Checklist |
| MigsEu | Minimal Information about a Genome Sequence: eukaryote | Checklist |
| MigsOrg | Minimal Information about a Genome Sequence: organelle | Checklist |
| MigsPl | Minimal Information about a Genome Sequence: plasmid | Checklist |
| MigsVi | Minimal Information about a Genome Sequence: virus | Checklist |
| Mimag | Minimum Information About a Metagenome-Assembled Genome | Checklist |
| MimarksS | Minimal Information about a Marker Sequence: survey | Checklist |
| Mims | Metagenome or Environmental | Checklist |
| Misag | Minimum Information About a Single Amplified Genome | Checklist |
| Miuvig | Minimum Information About an Uncultivated Virus Genome | Checklist |
| Agriculture | A collection of terms appropriate when sequencing samples obtained in an agri... | Extension |
| MimsHostAssociatedAncient | MIxS Data that comply with the Mims checklist, and HostAssociated and Ancient... | - |
| MimsHumanAssociatedAncient | MIxS Data that comply with the Mims checklist, and HumanAssociated and Ancien... | - |
| MimsHumanOralAncient | MIxS Data that comply with the Mims checklist, and HumanOral and Ancient exte... | - |
| MimsHumanGutAncient | MIxS Data that comply with the Mims checklist, and HumanGut and Ancient exten... | - |
| MimsHumanSkinAncient | MIxS Data that comply with the Mims checklist, and HumanSkin and Ancient exte... | - |
| MimsSedimentAncient | MIxS Data that comply with the Mims checklist, and Sediment and Ancient exten... | - |
| MimsSoilAncient | MIxS Data that comply with the Mims checklist, and Soil and Ancient extension... | - |
| MimsPlantAssociatedAncient | MIxS Data that comply with the Mims checklist, and PlantAssociated and Ancien... | - |
Properties
- Range: String
-
Cardinality: 0..1
-
Structured pattern:
^{dna_bases};{dna_bases}$
Examples
| Value |
|---|
| AATGATACGGCGACCACCGAGATCTACACGCT;CAAGCAGAAGACGGCATACGAGAT |
LinkML Source
name: adapters
description: Adapters provide priming sequences for both amplification and sequencing
of the sample-library fragments. Both adapters should be reported; in uppercase
letters
title: adapters
examples:
- value: AATGATACGGCGACCACCGAGATCTACACGCT;CAAGCAGAAGACGGCATACGAGAT
in_subset:
- sequencing
from_schema: https://w3id.org/mixs
slot_uri: MIXS:0000048
domain_of:
- MimsMisip
- MigsBa
- MigsEu
- MigsOrg
- MigsPl
- MigsVi
- Mimag
- MimarksS
- Mims
- Misag
- Miuvig
- Agriculture
- MimsHostAssociatedAncient
- MimsHumanAssociatedAncient
- MimsHumanOralAncient
- MimsHumanGutAncient
- MimsHumanSkinAncient
- MimsSedimentAncient
- MimsSoilAncient
- MimsPlantAssociatedAncient
range: string
structured_pattern:
syntax: ^{dna_bases};{dna_bases}$
interpolated: true
partial_match: true