Combination: Misag combined with WastewaterSludge (MisagWastewaterSludge)
MIxS Data that comply with the Misag checklist and the WastewaterSludge Extension
Composition
Misag [Checklist] + WastewaterSludge [Extension]
Terms
| MIXS ID | Name | Cardinality and Range | Description |
|---|---|---|---|
| MIXS:0001107 | samp_name | 1 String |
A local identifier or name that for the material sample used for extracting n... |
| MIXS:0000017 | size_frac | 0..1 String |
Filtering pore size used in sample preparation |
| MIXS:0000043 | lib_screen | 0..1 recommended String |
Specific enrichment or screening methods applied before and/or after creating... |
| MIXS:0000062 | ref_db | 0..1 String |
List of database(s) used for ORF annotation, along with version number and re... |
| MIXS:0000038 | nucl_acid_amp | 0..1 recommended String |
A link to a literature reference, electronic resource or a standard operating... |
| MIXS:0000039 | lib_size | 0..1 recommended Integer |
Total number of clones in the library prepared for the project |
| MIXS:0000005 | contam_screen_input | 0..1 ContamScreenInputEnum |
The type of sequence data used as input |
| MIXS:0000047 | mid | 0..1 recommended String |
Molecular barcodes, called Multiplex Identifiers (MIDs), that are used to spe... |
| MIXS:0000057 | assembly_name | 0..1 recommended String |
Name/version of the assembly provided by the submitter that is used in the ge... |
| MIXS:0000113 | temp | 0..1 recommended String |
Temperature of the sample at the time of sampling |
| MIXS:0000069 | compl_score | 1 String |
Completeness score is typically based on either the fraction of markers found... |
| MIXS:0000067 | trnas | 0..1 String |
The total number of tRNAs identified from the SAG or MAG |
| MIXS:0000037 | nucl_acid_ext | 0..1 recommended String |
A link to a literature reference, electronic resource or a standard operating... |
| MIXS:0000001 | samp_size | 0..1 recommended String |
The total amount or size (volume (ml), mass (g) or area (m2) ) of sample coll... |
| MIXS:0000094 | alt | 0..1 recommended String |
Heights of objects such as airplanes, space shuttles, rockets, atmospheric ba... |
| MIXS:0000026 | source_mat_id | * recommended String |
A unique identifier assigned to a material sample (as defined by http://rs |
| MIXS:0000111 | samp_vol_we_dna_ext | 0..1 String |
Volume (ml) or mass (g) of total collected sample processed for DNA extractio... |
| MIXS:0000040 | lib_reads_seqd | 0..1 recommended Integer |
Total number of clones sequenced from the library |
| MIXS:0000015 | rel_to_oxygen | 0..1 RelToOxygenEnum |
Is this organism an aerobe, anaerobe? Please note that aerobic and anaerobic ... |
| MIXS:0000006 | wga_amp_kit | 0..1 String |
Kit used to amplify genomic DNA in preparation for sequencing |
| MIXS:0000074 | decontam_software | 0..1 String |
Tool(s) used in contamination screening |
| MIXS:0000002 | samp_collect_device | 0..1 recommended String |
The device used to collect an environmental sample |
| MIXS:0000060 | number_contig | 0..1 Integer |
Total number of contigs in the cleaned/submitted assembly that makes up a giv... |
| MIXS:0000068 | trna_ext_software | 0..1 String |
Tools used for tRNA identification |
| MIXS:0000054 | sc_lysis_method | 0..1 String |
Name of the kit or standard protocol used for cell(s) or particle(s) lysis |
| MIXS:0000041 | lib_layout | 0..1 recommended LibLayoutEnum |
Specify whether to expect single, paired, or other configuration of reads |
| MIXS:0000073 | contam_screen_param | 0..1 String |
Specific parameters used in the decontamination sofware, such as reference da... |
| MIXS:0000056 | assembly_qual | 1 AssemblyQualEnum |
The assembly quality category is based on sets of criteria outlined for each ... |
| MIXS:0000025 | ref_biomaterial | 0..1 String |
Primary publication if isolated before genome publication; otherwise, primary... |
| MIXS:0000092 | project_name | 1 String |
Name of the project within which the sequencing was organized |
| MIXS:0000042 | lib_vector | 0..1 recommended String |
Cloning vector type(s) used in construction of libraries |
| MIXS:0000048 | adapters | 0..1 recommended String |
Adapters provide priming sequences for both amplification and sequencing of t... |
| MIXS:0001321 | neg_cont_type | 0..1 recommended NegContTypeEnum |
The substance or equipment used as a negative control in an investigation |
| MIXS:0000058 | assembly_software | 1 String |
Tool(s) used for assembly, including version number and parameters |
| MIXS:0000053 | tax_ident | 1 TaxIdentEnum |
The phylogenetic marker(s) used to assign an organism name to the SAG or MAG |
| MIXS:0000072 | contam_score | 1 Float |
The contamination score is based on the fraction of single-copy genes that ar... |
| MIXS:0000059 | annot | 0..1 String |
Tool used for annotation, or for cases where annotation was provided by a com... |
| MIXS:0000066 | x16s_recover_software | 0..1 String |
Tools used for 16S rRNA gene extraction |
| MIXS:0000065 | x16s_recover | 0..1 Boolean |
Can a 16S gene be recovered from the submitted SAG or MAG? |
| MIXS:0001322 | pos_cont_type | 0..1 recommended String |
The substance, mixture, product, or apparatus used to verify that a process w... |
| MIXS:0000061 | feat_pred | 0..1 String |
Method used to predict UViGs features such as ORFs, integration site, etc |
| MIXS:0000070 | compl_software | 1 String |
Tools used for completion estimate, i |
| MIXS:0000013 | env_local_scale | 1 String |
Report the entity or entities which are in the sample or specimen s local vic... |
| MIXS:0000075 | sort_tech | 1 SortTechEnum |
Method used to sort/isolate cells or particles of interest |
| MIXS:0000016 | samp_mat_process | 0..1 recommended String |
A brief description of any processing applied to the sample during or after r... |
| MIXS:0000063 | sim_search_meth | 0..1 String |
Tool used to compare ORFs with database, along with version and cutoffs used |
| MIXS:0000018 | depth | 0..1 recommended String |
The vertical distance below local surface |
| MIXS:0001225 | samp_collect_method | 0..1 recommended String |
The method employed for collecting the sample |
| MIXS:0000055 | wga_amp_appr | 1 WgaAmpApprEnum |
Method used to amplify genomic DNA in preparation for sequencing |
| MIXS:0000071 | compl_appr | 0..1 ComplApprEnum |
The approach used to determine the completeness of a given genomic assembly, ... |
| MIXS:0000014 | env_medium | 1 String |
Report the environmental material(s) immediately surrounding the sample or sp... |
| MIXS:0001320 | samp_taxon_id | 1 String |
NCBI taxon id of the sample |
| MIXS:0000010 | geo_loc_name | 1 String |
The geographical origin of the sample as defined by the country or sea name f... |
| MIXS:0000076 | sc_lysis_approach | 1 ScLysisApproachEnum |
Method used to free DNA from interior of the cell(s) or particle(s) |
| MIXS:0000011 | collection_date | 1 Datetime |
The time of sampling, either as an instance (single point in time) or interva... |
| MIXS:0000050 | seq_meth | 1 String |
Sequencing machine used |
| MIXS:0000009 | lat_lon | 1 String |
The geographical origin of the sample as defined by latitude and longitude |
| MIXS:0000093 | elev | 0..1 recommended String |
Elevation of the sampling site is its height above a fixed reference point, m... |
| MIXS:0000012 | env_broad_scale | 1 String |
Report the major environmental system the sample or specimen came from |
| MIXS:0000064 | tax_class | 0..1 String |
Method used for taxonomic classification, along with reference database used,... |
| MIXS:0000008 | experimental_factor | * recommended String |
Variable aspects of an experiment design that can be used to describe an expe... |
| MIXS:0000091 | associated_resource | * recommended String |
A related resource that is referenced, cited, or otherwise associated to the ... |
| MIXS:0000090 | sop | * recommended String |
Standard operating procedures used in assembly and/or annotation of genomes, ... |
| MIXS:0000421 | alkalinity | 0..1 String |
Alkalinity, the ability of a solution to neutralize acids to the equivalence ... |
| MIXS:0000653 | biochem_oxygen_dem | 0..1 String |
Amount of dissolved oxygen needed by aerobic biological organisms in a body o... |
| MIXS:0000751 | chem_administration | * String |
List of chemical compounds administered to the host or site where sampling oc... |
| MIXS:0000656 | chem_oxygen_dem | 0..1 String |
A measure of the capacity of water to consume oxygen during the decomposition... |
| MIXS:0000657 | efficiency_percent | 0..1 String |
Percentage of volatile solids removed from the anaerobic digestor |
| MIXS:0000660 | emulsions | * String |
Amount or concentration of substances such as paints, adhesives, mayonnaise, ... |
| MIXS:0000661 | gaseous_substances | * String |
Amount or concentration of substances such as hydrogen sulfide, carbon dioxid... |
| MIXS:0000662 | indust_eff_percent | 0..1 String |
Percentage of industrial effluents received by wastewater treatment plant |
| MIXS:0000664 | inorg_particles | * String |
Concentration of particles such as sand, grit, metal particles, ceramics, etc |
| MIXS:0000752 | misc_param | * String |
Any other measurement performed or parameter collected, that is not listed he... |
| MIXS:0000425 | nitrate | 0..1 String |
Concentration of nitrate in the sample |
| MIXS:0000665 | org_particles | * String |
Concentration of particles such as faeces, hairs, food, vomit, paper fibers, ... |
| MIXS:0000103 | organism_count | * String |
Total cell count of any organism (or group of organisms) per gram, volume or ... |
| MIXS:0000753 | oxy_stat_samp | 0..1 OxyStatSampEnum |
Oxygenation status of sample |
| MIXS:0001001 | ph | 0..1 Float |
pH measurement of the sample, or liquid portion of sample, or aqueous phase o... |
| MIXS:0000754 | perturbation | * String |
Type of perturbation, e |
| MIXS:0000505 | phosphate | 0..1 String |
Concentration of phosphate |
| MIXS:0000348 | pre_treatment | 0..1 String |
The process of pre-treatment removes materials that can be easily collected f... |
| MIXS:0000349 | primary_treatment | 0..1 String |
The process to produce both a generally homogeneous liquid capable of being t... |
| MIXS:0000350 | reactor_type | 0..1 String |
Anaerobic digesters can be designed and engineered to operate using a number ... |
| MIXS:0000183 | salinity | 0..1 String |
The total concentration of all dissolved salts in a liquid or solid sample |
| MIXS:0000116 | samp_store_dur | 0..1 String |
Duration for which the sample was stored |
| MIXS:0000755 | samp_store_loc | 0..1 String |
Location at which sample was stored, usually name of a specific freezer/room |
| MIXS:0000110 | samp_store_temp | 0..1 String |
Temperature at which sample was stored, e |
| MIXS:0000351 | secondary_treatment | 0..1 String |
The process for substantially degrading the biological content of the sewage |
| MIXS:0000215 | sewage_type | 0..1 String |
Type of wastewater treatment plant as municipial or industrial |
| MIXS:0000669 | sludge_retent_time | 0..1 String |
The time activated sludge remains in reactor |
| MIXS:0000428 | sodium | 0..1 String |
Sodium concentration in the sample |
| MIXS:0000672 | soluble_inorg_mat | * String |
Concentration of substances such as ammonia, road-salt, sea-salt, cyanide, hy... |
| MIXS:0000673 | soluble_org_mat | * String |
Concentration of substances such as urea, fruit sugars, soluble proteins, dru... |
| MIXS:0000150 | suspend_solids | * String |
Concentration of substances including a wide variety of material, such as sil... |
| MIXS:0000352 | tertiary_treatment | 0..1 String |
The process providing a final treatment stage to raise the effluent quality b... |
| MIXS:0000102 | tot_nitro | 0..1 String |
Total nitrogen concentration of water samples, calculated by: total nitrogen ... |
| MIXS:0000689 | tot_phosphate | 0..1 String |
Total amount or concentration of phosphate |
| MIXS:0000353 | wastewater_type | 0..1 String |
The origin of wastewater such as human waste, rainfall, storm drains, etc |
LinkML Source
Direct
name: MisagWastewaterSludge
description: MIxS Data that comply with the Misag checklist and the WastewaterSludge
Extension
title: Misag combined with WastewaterSludge
in_subset:
- combination_classes
from_schema: https://w3id.org/mixs
is_a: WastewaterSludge
mixins:
- Misag
class_uri: MIXS:0010010_0016013
Induced
name: MisagWastewaterSludge
description: MIxS Data that comply with the Misag checklist and the WastewaterSludge
Extension
title: Misag combined with WastewaterSludge
in_subset:
- combination_classes
from_schema: https://w3id.org/mixs
is_a: WastewaterSludge
mixins:
- Misag
attributes:
samp_name:
name: samp_name
annotations:
Preferred_unit:
tag: Preferred_unit
value: ''
description: A local identifier or name that for the material sample used for
extracting nucleic acids, and subsequent sequencing. It can refer either to
the original material collected or to any derived sub-samples. It can have any
format, but we suggest that you make it concise, unique and consistent within
your lab, and as informative as possible. INSDC requires every sample name from
a single Submitter to be unique. Use of a globally unique identifier for the
field source_mat_id is recommended in addition to sample_name
title: sample name
examples:
- value: ISDsoil1
in_subset:
- investigation
from_schema: https://w3id.org/mixs
keywords:
- sample
slot_uri: MIXS:0001107
alias: samp_name
owner: MisagWastewaterSludge
domain_of:
- MigsBa
- MigsEu
- MigsOrg
- MigsPl
- MigsVi
- Mimag
- MimarksC
- MimarksS
- Mims
- Misag
- Miuvig
- Air
- BuiltEnvironment
- FoodAnimalAndAnimalFeed
- FoodFarmEnvironment
- FoodFoodProductionFacility
- FoodHumanFoods
- HostAssociated
- HumanAssociated
- HumanGut
- HumanOral
- HumanSkin
- HumanVaginal
- HydrocarbonResourcesCores
- HydrocarbonResourcesFluidsSwabs
- MicrobialMatBiofilm
- MiscellaneousNaturalOrArtificialEnvironment
- PlantAssociated
- Sediment
- Soil
- SymbiontAssociated
- WastewaterSludge
- Water
range: string
required: true
size_frac:
name: size_frac
annotations:
Expected_value:
tag: Expected_value
value: filter size value range
description: Filtering pore size used in sample preparation
title: size fraction selected
examples:
- value: 0-0.22 micrometer
in_subset:
- nucleic acid sequence source
from_schema: https://w3id.org/mixs
keywords:
- fraction
- size
string_serialization: '{float}-{float} {unit}'
slot_uri: MIXS:0000017
alias: size_frac
owner: MisagWastewaterSludge
domain_of:
- Mimag
- MimarksS
- Mims
- Misag
- Miuvig
range: string
lib_screen:
name: lib_screen
annotations:
Expected_value:
tag: Expected_value
value: screening strategy name
description: Specific enrichment or screening methods applied before and/or after
creating libraries
title: library screening strategy
examples:
- value: enriched, screened, normalized
in_subset:
- sequencing
from_schema: https://w3id.org/mixs
keywords:
- library
slot_uri: MIXS:0000043
alias: lib_screen
owner: MisagWastewaterSludge
domain_of:
- MigsBa
- MigsEu
- MigsOrg
- MigsPl
- MigsVi
- Mimag
- MimarksS
- Mims
- Misag
- Miuvig
- Agriculture
range: string
recommended: true
ref_db:
name: ref_db
annotations:
Expected_value:
tag: Expected_value
value: names, versions, and references of databases
description: List of database(s) used for ORF annotation, along with version number
and reference to website or publication
title: reference database(s)
examples:
- value: pVOGs;5;http://dmk-brain.ecn.uiowa.edu/pVOGs/ Grazziotin et al. 2017
doi:10.1093/nar/gkw975
in_subset:
- sequencing
from_schema: https://w3id.org/mixs
keywords:
- database
string_serialization: '{database};{version};{reference}'
slot_uri: MIXS:0000062
alias: ref_db
owner: MisagWastewaterSludge
domain_of:
- MigsBa
- MigsEu
- MigsOrg
- MigsPl
- MigsVi
- Mimag
- Mims
- Misag
- Miuvig
range: string
nucl_acid_amp:
name: nucl_acid_amp
description: A link to a literature reference, electronic resource or a standard
operating procedure (SOP), that describes the enzymatic amplification (PCR,
TMA, NASBA) of specific nucleic acids
title: nucleic acid amplification
examples:
- value: https://phylogenomics.me/protocols/16s-pcr-protocol/
in_subset:
- sequencing
from_schema: https://w3id.org/mixs
slot_uri: MIXS:0000038
alias: nucl_acid_amp
owner: MisagWastewaterSludge
domain_of:
- MigsBa
- MigsEu
- MigsOrg
- MigsPl
- MigsVi
- Mimag
- MimarksC
- MimarksS
- Mims
- Misag
- Miuvig
- Agriculture
range: string
recommended: true
structured_pattern:
syntax: ^{PMID}|{DOI}|{URL}$
interpolated: true
partial_match: true
lib_size:
name: lib_size
description: Total number of clones in the library prepared for the project
title: library size
examples:
- value: '50'
in_subset:
- sequencing
from_schema: https://w3id.org/mixs
keywords:
- library
- size
slot_uri: MIXS:0000039
alias: lib_size
owner: MisagWastewaterSludge
domain_of:
- MigsBa
- MigsEu
- MigsOrg
- MigsPl
- MigsVi
- Mimag
- MimarksS
- Mims
- Misag
- Miuvig
- Agriculture
range: integer
recommended: true
contam_screen_input:
name: contam_screen_input
description: The type of sequence data used as input
title: contamination screening input
examples:
- value: contigs
in_subset:
- sequencing
from_schema: https://w3id.org/mixs
slot_uri: MIXS:0000005
alias: contam_screen_input
owner: MisagWastewaterSludge
domain_of:
- Mimag
- Misag
range: ContamScreenInputEnum
mid:
name: mid
description: Molecular barcodes, called Multiplex Identifiers (MIDs), that are
used to specifically tag unique samples in a sequencing run. Sequence should
be reported in uppercase letters
title: multiplex identifiers
examples:
- value: GTGAATAT
in_subset:
- sequencing
from_schema: https://w3id.org/mixs
keywords:
- identifier
slot_uri: MIXS:0000047
alias: mid
owner: MisagWastewaterSludge
domain_of:
- Mimag
- MimarksS
- Mims
- Misag
- Miuvig
- Agriculture
range: string
recommended: true
structured_pattern:
syntax: ^{dna_bases}$
interpolated: true
partial_match: true
assembly_name:
name: assembly_name
annotations:
Expected_value:
tag: Expected_value
value: name and version of assembly
description: Name/version of the assembly provided by the submitter that is used
in the genome browsers and in the community
title: assembly name
examples:
- value: HuRef, JCVI_ISG_i3_1.0
in_subset:
- sequencing
from_schema: https://w3id.org/mixs
string_serialization: '{text} {text}'
slot_uri: MIXS:0000057
alias: assembly_name
owner: MisagWastewaterSludge
domain_of:
- MigsBa
- MigsEu
- MigsOrg
- MigsPl
- MigsVi
- Mimag
- Mims
- Misag
- Miuvig
- Agriculture
range: string
recommended: true
temp:
name: temp
annotations:
Preferred_unit:
tag: Preferred_unit
value: degree Celsius
description: Temperature of the sample at the time of sampling
title: temperature
examples:
- value: 25 degree Celsius
in_subset:
- environment
from_schema: https://w3id.org/mixs
keywords:
- temperature
slot_uri: MIXS:0000113
alias: temp
owner: MisagWastewaterSludge
domain_of:
- MigsBa
- MigsEu
- MigsOrg
- MigsPl
- MigsVi
- Mimag
- MimarksC
- MimarksS
- Mims
- Misag
- Miuvig
- Agriculture
- Air
- FoodAnimalAndAnimalFeed
- FoodFarmEnvironment
- FoodHumanFoods
- HostAssociated
- HumanAssociated
- HumanGut
- HumanOral
- HumanSkin
- HumanVaginal
- HydrocarbonResourcesCores
- HydrocarbonResourcesFluidsSwabs
- MicrobialMatBiofilm
- MiscellaneousNaturalOrArtificialEnvironment
- PlantAssociated
- Sediment
- Soil
- SymbiontAssociated
- WastewaterSludge
- Water
range: string
recommended: true
structured_pattern:
syntax: ^{scientific_float}( *- *{scientific_float})? *{text}$
interpolated: true
partial_match: true
compl_score:
name: compl_score
annotations:
Expected_value:
tag: Expected_value
value: quality;percent completeness
description: 'Completeness score is typically based on either the fraction of
markers found as compared to a database or the percent of a genome found as
compared to a closely related reference genome. High Quality Draft: >90%, Medium
Quality Draft: >50%, and Low Quality Draft: < 50% should have the indicated
completeness scores'
title: completeness score
examples:
- value: med;60%
in_subset:
- sequencing
from_schema: https://w3id.org/mixs
keywords:
- score
string_serialization: '[high|med|low];{percentage}'
slot_uri: MIXS:0000069
alias: compl_score
owner: MisagWastewaterSludge
domain_of:
- MigsBa
- MigsEu
- MigsOrg
- MigsPl
- MigsVi
- Mimag
- Misag
- Miuvig
range: string
required: true
trnas:
name: trnas
annotations:
Expected_value:
tag: Expected_value
value: value from 0-21
description: The total number of tRNAs identified from the SAG or MAG
title: number of standard tRNAs extracted
examples:
- value: '18'
in_subset:
- sequencing
from_schema: https://w3id.org/mixs
keywords:
- number
string_serialization: '{integer}'
slot_uri: MIXS:0000067
alias: trnas
owner: MisagWastewaterSludge
domain_of:
- Mimag
- Misag
- Miuvig
range: string
nucl_acid_ext:
name: nucl_acid_ext
description: A link to a literature reference, electronic resource or a standard
operating procedure (SOP), that describes the material separation to recover
the nucleic acid fraction from a sample
title: nucleic acid extraction
examples:
- value: https://mobio.com/media/wysiwyg/pdfs/protocols/12888.pdf
in_subset:
- sequencing
from_schema: https://w3id.org/mixs
slot_uri: MIXS:0000037
alias: nucl_acid_ext
owner: MisagWastewaterSludge
domain_of:
- MigsBa
- MigsEu
- MigsOrg
- MigsPl
- MigsVi
- Mimag
- MimarksC
- MimarksS
- Mims
- Misag
- Miuvig
- Agriculture
- FoodAnimalAndAnimalFeed
- FoodFarmEnvironment
- FoodFoodProductionFacility
- FoodHumanFoods
range: string
recommended: true
structured_pattern:
syntax: ^{PMID}|{DOI}|{URL}$
interpolated: true
partial_match: true
samp_size:
name: samp_size
description: The total amount or size (volume (ml), mass (g) or area (m2) ) of
sample collected
title: amount or size of sample collected
examples:
- value: 5 liter
in_subset:
- nucleic acid sequence source
from_schema: https://w3id.org/mixs
keywords:
- sample
- size
slot_uri: MIXS:0000001
alias: samp_size
owner: MisagWastewaterSludge
domain_of:
- MigsBa
- MigsEu
- MigsOrg
- MigsPl
- MigsVi
- Mimag
- MimarksC
- MimarksS
- Mims
- Misag
- Miuvig
- Agriculture
- FoodAnimalAndAnimalFeed
- FoodFarmEnvironment
- FoodFoodProductionFacility
- FoodHumanFoods
range: string
recommended: true
structured_pattern:
syntax: ^{scientific_float}( *- *{scientific_float})? *{text}$
interpolated: true
partial_match: true
alt:
name: alt
annotations:
Preferred_unit:
tag: Preferred_unit
value: meter
description: Heights of objects such as airplanes, space shuttles, rockets, atmospheric
balloons and heights of places such as atmospheric layers and clouds. It is
used to measure the height of an object which is above the earth's surface.
In this context, the altitude measurement is the vertical distance between the
earth's surface above sea level and the sampled position in the air
title: altitude
examples:
- value: 100 meter
in_subset:
- environment
from_schema: https://w3id.org/mixs
slot_uri: MIXS:0000094
alias: alt
owner: MisagWastewaterSludge
domain_of:
- MigsBa
- MigsEu
- MigsOrg
- MigsPl
- MigsVi
- Mimag
- MimarksC
- MimarksS
- Mims
- Misag
- Miuvig
- Air
- HostAssociated
- MiscellaneousNaturalOrArtificialEnvironment
- SymbiontAssociated
range: string
recommended: true
structured_pattern:
syntax: ^{scientific_float}( *- *{scientific_float})? *{text}$
interpolated: true
partial_match: true
source_mat_id:
name: source_mat_id
annotations:
Expected_value:
tag: Expected_value
value: 'for cultures of microorganisms: identifiers for two culture collections;
for other material a unique arbitrary identifer'
description: A unique identifier assigned to a material sample (as defined by
http://rs.tdwg.org/dwc/terms/materialSampleID, and as opposed to a particular
digital record of a material sample) used for extracting nucleic acids, and
subsequent sequencing. The identifier can refer either to the original material
collected or to any derived sub-samples. The INSDC qualifiers /specimen_voucher,
/bio_material, or /culture_collection may or may not share the same value as
the source_mat_id field. For instance, the /specimen_voucher qualifier and source_mat_id
may both contain 'UAM:Herps:14' , referring to both the specimen voucher and
sampled tissue with the same identifier. However, the /culture_collection qualifier
may refer to a value from an initial culture (e.g. ATCC:11775) while source_mat_id
would refer to an identifier from some derived culture from which the nucleic
acids were extracted (e.g. xatc123 or ark:/2154/R2)
title: source material identifiers
examples:
- value: MPI012345
in_subset:
- nucleic acid sequence source
from_schema: https://w3id.org/mixs
keywords:
- identifier
- material
- source
slot_uri: MIXS:0000026
alias: source_mat_id
owner: MisagWastewaterSludge
domain_of:
- MigsBa
- MigsEu
- MigsOrg
- MigsPl
- MigsVi
- Mimag
- MimarksC
- MimarksS
- Mims
- Misag
- Miuvig
- Agriculture
- SymbiontAssociated
range: string
recommended: true
multivalued: true
samp_vol_we_dna_ext:
name: samp_vol_we_dna_ext
annotations:
Preferred_unit:
tag: Preferred_unit
value: milliliter, gram, milligram, square centimeter
description: 'Volume (ml) or mass (g) of total collected sample processed for
DNA extraction. Note: total sample collected should be entered under the term
Sample Size (MIXS:0000001)'
title: sample volume or weight for DNA extraction
examples:
- value: 1500 milliliter
in_subset:
- nucleic acid sequence source
from_schema: https://w3id.org/mixs
keywords:
- dna
- sample
- volume
- weight
slot_uri: MIXS:0000111
alias: samp_vol_we_dna_ext
owner: MisagWastewaterSludge
domain_of:
- MigsBa
- MigsEu
- MigsOrg
- MigsPl
- MigsVi
- Mimag
- MimarksC
- MimarksS
- Mims
- Misag
- Miuvig
- Agriculture
- Air
- FoodAnimalAndAnimalFeed
- FoodFarmEnvironment
- FoodFoodProductionFacility
- FoodHumanFoods
- HostAssociated
- HumanAssociated
- HumanGut
- HumanOral
- HumanSkin
- HumanVaginal
- HydrocarbonResourcesCores
- HydrocarbonResourcesFluidsSwabs
- MicrobialMatBiofilm
- MiscellaneousNaturalOrArtificialEnvironment
- PlantAssociated
- Sediment
- Soil
- SymbiontAssociated
- WastewaterSludge
- Water
range: string
structured_pattern:
syntax: ^{scientific_float}( *- *{scientific_float})? *{text}$
interpolated: true
partial_match: true
lib_reads_seqd:
name: lib_reads_seqd
description: Total number of clones sequenced from the library
title: library reads sequenced
examples:
- value: '20'
in_subset:
- sequencing
from_schema: https://w3id.org/mixs
keywords:
- library
slot_uri: MIXS:0000040
alias: lib_reads_seqd
owner: MisagWastewaterSludge
domain_of:
- MigsBa
- MigsEu
- MigsOrg
- MigsPl
- MigsVi
- Mimag
- MimarksS
- Mims
- Misag
- Miuvig
- Agriculture
range: integer
recommended: true
rel_to_oxygen:
name: rel_to_oxygen
description: Is this organism an aerobe, anaerobe? Please note that aerobic and
anaerobic are valid descriptors for microbial environments
title: relationship to oxygen
examples:
- value: aerobe
in_subset:
- nucleic acid sequence source
from_schema: https://w3id.org/mixs
keywords:
- oxygen
- relationship
slot_uri: MIXS:0000015
alias: rel_to_oxygen
owner: MisagWastewaterSludge
domain_of:
- MigsBa
- Mimag
- MimarksC
- MimarksS
- Mims
- Misag
range: RelToOxygenEnum
wga_amp_kit:
name: wga_amp_kit
annotations:
Expected_value:
tag: Expected_value
value: kit name
description: Kit used to amplify genomic DNA in preparation for sequencing
title: WGA amplification kit
examples:
- value: qiagen repli-g
in_subset:
- sequencing
from_schema: https://w3id.org/mixs
keywords:
- kit
slot_uri: MIXS:0000006
alias: wga_amp_kit
owner: MisagWastewaterSludge
domain_of:
- Misag
- Miuvig
range: string
decontam_software:
name: decontam_software
annotations:
Expected_value:
tag: Expected_value
value: enumeration
description: Tool(s) used in contamination screening
title: decontamination software
examples:
- value: anvi'o
in_subset:
- sequencing
from_schema: https://w3id.org/mixs
keywords:
- software
string_serialization: '[checkm/refinem|anvi''o|prodege|bbtools:decontaminate.sh|acdc|combination]'
slot_uri: MIXS:0000074
alias: decontam_software
owner: MisagWastewaterSludge
domain_of:
- Mimag
- Misag
range: string
samp_collect_device:
name: samp_collect_device
annotations:
Expected_value:
tag: Expected_value
value: device name
description: The device used to collect an environmental sample. This field accepts
terms listed under environmental sampling device (http://purl.obolibrary.org/obo/ENVO).
This field also accepts terms listed under specimen collection device (http://purl.obolibrary.org/obo/GENEPIO_0002094)
title: sample collection device
examples:
- value: swab, biopsy, niskin bottle, push core, drag swab [GENEPIO:0002713]
in_subset:
- nucleic acid sequence source
from_schema: https://w3id.org/mixs
keywords:
- device
- sample
string_serialization: '{termLabel} [{termID}]|{text}'
slot_uri: MIXS:0000002
alias: samp_collect_device
owner: MisagWastewaterSludge
domain_of:
- MigsBa
- MigsEu
- MigsOrg
- MigsPl
- MigsVi
- Mimag
- MimarksC
- MimarksS
- Mims
- Misag
- Miuvig
- Agriculture
- FoodAnimalAndAnimalFeed
- FoodFarmEnvironment
- FoodFoodProductionFacility
- FoodHumanFoods
range: string
recommended: true
number_contig:
name: number_contig
description: Total number of contigs in the cleaned/submitted assembly that makes
up a given genome, SAG, MAG, or UViG
title: number of contigs
examples:
- value: '40'
in_subset:
- sequencing
from_schema: https://w3id.org/mixs
keywords:
- number
slot_uri: MIXS:0000060
alias: number_contig
owner: MisagWastewaterSludge
domain_of:
- MigsBa
- MigsEu
- MigsOrg
- MigsPl
- MigsVi
- Mimag
- Mims
- Misag
- Miuvig
range: integer
trna_ext_software:
name: trna_ext_software
description: Tools used for tRNA identification
title: tRNA extraction software
examples:
- value: infernal;v2;default parameters
in_subset:
- sequencing
from_schema: https://w3id.org/mixs
keywords:
- software
slot_uri: MIXS:0000068
alias: trna_ext_software
owner: MisagWastewaterSludge
domain_of:
- Mimag
- Misag
- Miuvig
range: string
structured_pattern:
syntax: ^{software};{version};{parameters}$
interpolated: true
partial_match: true
sc_lysis_method:
name: sc_lysis_method
annotations:
Expected_value:
tag: Expected_value
value: kit, protocol name
description: Name of the kit or standard protocol used for cell(s) or particle(s)
lysis
title: single cell or viral particle lysis kit protocol
examples:
- value: ambion single cell lysis kit
in_subset:
- sequencing
from_schema: https://w3id.org/mixs
keywords:
- kit
- particle
- protocol
- single
slot_uri: MIXS:0000054
alias: sc_lysis_method
owner: MisagWastewaterSludge
domain_of:
- Misag
- Miuvig
range: string
lib_layout:
name: lib_layout
description: Specify whether to expect single, paired, or other configuration
of reads
title: library layout
examples:
- value: paired
in_subset:
- sequencing
from_schema: https://w3id.org/mixs
keywords:
- library
slot_uri: MIXS:0000041
alias: lib_layout
owner: MisagWastewaterSludge
domain_of:
- MigsBa
- MigsEu
- MigsOrg
- MigsPl
- MigsVi
- Mimag
- MimarksS
- Mims
- Misag
- Miuvig
- Agriculture
range: LibLayoutEnum
recommended: true
contam_screen_param:
name: contam_screen_param
annotations:
Expected_value:
tag: Expected_value
value: enumeration;value or name
description: Specific parameters used in the decontamination sofware, such as
reference database, coverage, and kmers. Combinations of these parameters may
also be used, i.e. kmer and coverage, or reference database and kmer
title: contamination screening parameters
examples:
- value: kmer
in_subset:
- sequencing
from_schema: https://w3id.org/mixs
keywords:
- parameter
string_serialization: '[ref db|kmer|coverage|combination];{text|integer}'
slot_uri: MIXS:0000073
alias: contam_screen_param
owner: MisagWastewaterSludge
domain_of:
- Mimag
- Misag
range: string
assembly_qual:
name: assembly_qual
description: 'The assembly quality category is based on sets of criteria outlined
for each assembly quality category. For MISAG/MIMAG; Finished: Single, validated,
contiguous sequence per replicon without gaps or ambiguities with a consensus
error rate equivalent to Q50 or better. High Quality Draft:Multiple fragments
where gaps span repetitive regions. Presence of the large subunit (LSU) RNA,
small subunit (SSU) and the presence of 5.8S rRNA or 5S rRNA depending on whether
it is a eukaryotic or prokaryotic genome, respectively. Medium Quality Draft:Many
fragments with little to no review of assembly other than reporting of standard
assembly statistics. Low Quality Draft:Many fragments with little to no review
of assembly other than reporting of standard assembly statistics. Assembly statistics
include, but are not limited to total assembly size, number of contigs, contig
N50/L50, and maximum contig length. For MIUVIG; Finished: Single, validated,
contiguous sequence per replicon without gaps or ambiguities, with extensive
manual review and editing to annotate putative gene functions and transcriptional
units. High-quality draft genome: One or multiple fragments, totaling 90%
of the expected genome or replicon sequence or predicted complete. Genome fragment(s):
One or multiple fragments, totalling < 90% of the expected genome or replicon
sequence, or for which no genome size could be estimated'
title: assembly quality
examples:
- value: High-quality draft genome
in_subset:
- sequencing
from_schema: https://w3id.org/mixs
keywords:
- quality
slot_uri: MIXS:0000056
alias: assembly_qual
owner: MisagWastewaterSludge
domain_of:
- MigsBa
- MigsEu
- MigsOrg
- MigsPl
- MigsVi
- Mimag
- Mims
- Misag
- Miuvig
- Agriculture
range: AssemblyQualEnum
required: true
ref_biomaterial:
name: ref_biomaterial
description: Primary publication if isolated before genome publication; otherwise,
primary genome report
title: reference for biomaterial
examples:
- value: doi:10.1016/j.syapm.2018.01.009
in_subset:
- nucleic acid sequence source
from_schema: https://w3id.org/mixs
slot_uri: MIXS:0000025
alias: ref_biomaterial
owner: MisagWastewaterSludge
domain_of:
- MigsBa
- MigsEu
- MigsOrg
- MigsPl
- MigsVi
- Mimag
- Mims
- Misag
- Miuvig
range: string
structured_pattern:
syntax: ^{PMID}|{DOI}|{URL}$
interpolated: true
partial_match: true
project_name:
name: project_name
description: Name of the project within which the sequencing was organized
title: project name
examples:
- value: Forest soil metagenome
in_subset:
- investigation
from_schema: https://w3id.org/mixs
keywords:
- project
slot_uri: MIXS:0000092
alias: project_name
owner: MisagWastewaterSludge
domain_of:
- MigsBa
- MigsEu
- MigsOrg
- MigsPl
- MigsVi
- Mimag
- MimarksC
- MimarksS
- Mims
- Misag
- Miuvig
- Air
- BuiltEnvironment
- FoodAnimalAndAnimalFeed
- FoodFarmEnvironment
- FoodFoodProductionFacility
- FoodHumanFoods
- HostAssociated
- HumanAssociated
- HumanGut
- HumanOral
- HumanSkin
- HumanVaginal
- HydrocarbonResourcesCores
- HydrocarbonResourcesFluidsSwabs
- MicrobialMatBiofilm
- MiscellaneousNaturalOrArtificialEnvironment
- PlantAssociated
- Sediment
- Soil
- SymbiontAssociated
- WastewaterSludge
- Water
range: string
required: true
lib_vector:
name: lib_vector
annotations:
Expected_value:
tag: Expected_value
value: vector
description: Cloning vector type(s) used in construction of libraries
title: library vector
examples:
- value: Bacteriophage P1
in_subset:
- sequencing
from_schema: https://w3id.org/mixs
keywords:
- library
slot_uri: MIXS:0000042
alias: lib_vector
owner: MisagWastewaterSludge
domain_of:
- MigsBa
- MigsEu
- MigsOrg
- MigsPl
- MigsVi
- Mimag
- MimarksS
- Mims
- Misag
- Miuvig
- Agriculture
range: string
recommended: true
adapters:
name: adapters
description: Adapters provide priming sequences for both amplification and sequencing
of the sample-library fragments. Both adapters should be reported; in uppercase
letters
title: adapters
examples:
- value: AATGATACGGCGACCACCGAGATCTACACGCT;CAAGCAGAAGACGGCATACGAGAT
in_subset:
- sequencing
from_schema: https://w3id.org/mixs
slot_uri: MIXS:0000048
alias: adapters
owner: MisagWastewaterSludge
domain_of:
- MigsBa
- MigsEu
- MigsOrg
- MigsPl
- MigsVi
- Mimag
- MimarksS
- Mims
- Misag
- Miuvig
- Agriculture
range: string
recommended: true
structured_pattern:
syntax: ^{dna_bases};{dna_bases}$
interpolated: true
partial_match: true
neg_cont_type:
name: neg_cont_type
annotations:
Expected_value:
tag: Expected_value
value: enumeration or text
description: The substance or equipment used as a negative control in an investigation
title: negative control type
in_subset:
- investigation
from_schema: https://w3id.org/mixs
keywords:
- type
slot_uri: MIXS:0001321
alias: neg_cont_type
owner: MisagWastewaterSludge
domain_of:
- MigsBa
- MigsEu
- MigsOrg
- MigsPl
- MigsVi
- Mimag
- MimarksC
- MimarksS
- Mims
- Misag
- Miuvig
range: NegContTypeEnum
recommended: true
assembly_software:
name: assembly_software
description: Tool(s) used for assembly, including version number and parameters
title: assembly software
examples:
- value: metaSPAdes;3.11.0;kmer set 21,33,55,77,99,121, default parameters otherwise
in_subset:
- sequencing
from_schema: https://w3id.org/mixs
keywords:
- software
slot_uri: MIXS:0000058
alias: assembly_software
owner: MisagWastewaterSludge
domain_of:
- MigsBa
- MigsEu
- MigsOrg
- MigsPl
- MigsVi
- Mimag
- MimarksS
- Mims
- Misag
- Miuvig
- Agriculture
range: string
required: true
structured_pattern:
syntax: ^{software};{version};{parameters}$
interpolated: true
partial_match: true
tax_ident:
name: tax_ident
description: The phylogenetic marker(s) used to assign an organism name to the
SAG or MAG
title: taxonomic identity marker
examples:
- value: other
description: was other <colon> rpoB gene
in_subset:
- sequencing
from_schema: https://w3id.org/mixs
keywords:
- identifier
- marker
- taxon
slot_uri: MIXS:0000053
alias: tax_ident
owner: MisagWastewaterSludge
domain_of:
- MigsBa
- MigsEu
- MigsOrg
- MigsPl
- MigsVi
- Mimag
- Misag
- Miuvig
range: TaxIdentEnum
required: true
contam_score:
name: contam_score
description: 'The contamination score is based on the fraction of single-copy
genes that are observed more than once in a query genome. The following scores
are acceptable for; High Quality Draft: < 5%, Medium Quality Draft: < 10%, Low
Quality Draft: < 10%. Contamination must be below 5% for a SAG or MAG to be
deposited into any of the public databases'
title: contamination score
examples:
- value: '0.01'
in_subset:
- sequencing
from_schema: https://w3id.org/mixs
keywords:
- score
slot_uri: MIXS:0000072
alias: contam_score
owner: MisagWastewaterSludge
domain_of:
- Mimag
- Misag
range: float
required: true
annot:
name: annot
annotations:
Expected_value:
tag: Expected_value
value: name of tool or pipeline used, or annotation source description
description: Tool used for annotation, or for cases where annotation was provided
by a community jamboree or model organism database rather than by a specific
submitter
title: annotation
examples:
- value: prokka
in_subset:
- sequencing
from_schema: https://w3id.org/mixs
slot_uri: MIXS:0000059
alias: annot
owner: MisagWastewaterSludge
domain_of:
- MigsBa
- MigsEu
- MigsOrg
- MigsPl
- MigsVi
- Mimag
- Mims
- Misag
- Miuvig
- Agriculture
range: string
x16s_recover_software:
name: x16s_recover_software
description: Tools used for 16S rRNA gene extraction
title: 16S recovery software
examples:
- value: rambl;v2;default parameters
in_subset:
- sequencing
from_schema: https://w3id.org/mixs
keywords:
- recover
- software
slot_uri: MIXS:0000066
alias: x16s_recover_software
owner: MisagWastewaterSludge
domain_of:
- Mimag
- Misag
range: string
structured_pattern:
syntax: ^{software};{version};{parameters}$
interpolated: true
partial_match: true
x16s_recover:
name: x16s_recover
description: Can a 16S gene be recovered from the submitted SAG or MAG?
title: 16S recovered
examples:
- value: 'yes'
in_subset:
- sequencing
from_schema: https://w3id.org/mixs
keywords:
- recover
slot_uri: MIXS:0000065
alias: x16s_recover
owner: MisagWastewaterSludge
domain_of:
- Mimag
- Misag
range: boolean
pos_cont_type:
name: pos_cont_type
description: The substance, mixture, product, or apparatus used to verify that
a process which is part of an investigation delivers a true positive
title: positive control type
in_subset:
- investigation
from_schema: https://w3id.org/mixs
keywords:
- type
string_serialization: '{term} or {text}'
slot_uri: MIXS:0001322
alias: pos_cont_type
owner: MisagWastewaterSludge
domain_of:
- MigsBa
- MigsEu
- MigsOrg
- MigsPl
- MigsVi
- Mimag
- MimarksC
- MimarksS
- Mims
- Misag
- Miuvig
range: string
recommended: true
feat_pred:
name: feat_pred
description: Method used to predict UViGs features such as ORFs, integration site,
etc
title: feature prediction
examples:
- value: Prodigal;2.6.3;default parameters
in_subset:
- sequencing
from_schema: https://w3id.org/mixs
keywords:
- feature
- predict
slot_uri: MIXS:0000061
alias: feat_pred
owner: MisagWastewaterSludge
domain_of:
- MigsBa
- MigsEu
- MigsOrg
- MigsPl
- MigsVi
- Mimag
- Mims
- Misag
- Miuvig
range: string
structured_pattern:
syntax: ^{software};{version};{parameters}$
interpolated: true
partial_match: true
compl_software:
name: compl_software
annotations:
Expected_value:
tag: Expected_value
value: names and versions of software(s) used
description: Tools used for completion estimate, i.e. checkm, anvi'o, busco
title: completeness software
examples:
- value: checkm
in_subset:
- sequencing
from_schema: https://w3id.org/mixs
keywords:
- software
string_serialization: '{software};{version}'
slot_uri: MIXS:0000070
alias: compl_software
owner: MisagWastewaterSludge
domain_of:
- MigsBa
- MigsEu
- MigsOrg
- MigsPl
- MigsVi
- Mimag
- Misag
- Miuvig
range: string
required: true
env_local_scale:
name: env_local_scale
annotations:
Expected_value:
tag: Expected_value
value: Environmental entities having causal influences upon the entity at
time of sampling
description: 'Report the entity or entities which are in the sample or specimen
s local vicinity and which you believe have significant causal influences on
your sample or specimen. We recommend using EnvO terms which are of smaller
spatial grain than your entry for env_broad_scale. Terms, such as anatomical
sites, from other OBO Library ontologies which interoperate with EnvO (e.g.
UBERON) are accepted in this field. EnvO documentation about how to use the
field: https://github.com/EnvironmentOntology/envo/wiki/Using-ENVO-with-MIxS'
title: local environmental context
examples:
- value: hillside [ENVO:01000333]
in_subset:
- environment
from_schema: https://w3id.org/mixs
keywords:
- context
- environmental
slot_uri: MIXS:0000013
alias: env_local_scale
owner: MisagWastewaterSludge
domain_of:
- MigsBa
- MigsEu
- MigsOrg
- MigsPl
- MigsVi
- Mimag
- MimarksC
- MimarksS
- Mims
- Misag
- Miuvig
range: string
required: true
structured_pattern:
syntax: ^{termLabel} \[{termID}\]$
interpolated: true
partial_match: true
sort_tech:
name: sort_tech
description: Method used to sort/isolate cells or particles of interest
title: sorting technology
examples:
- value: optical manipulation
in_subset:
- sequencing
from_schema: https://w3id.org/mixs
slot_uri: MIXS:0000075
alias: sort_tech
owner: MisagWastewaterSludge
domain_of:
- Misag
- Miuvig
range: SortTechEnum
required: true
samp_mat_process:
name: samp_mat_process
description: A brief description of any processing applied to the sample during
or after retrieving the sample from environment, or a link to the relevant protocol(s)
performed
title: sample material processing
examples:
- value: filtering of seawater, storing samples in ethanol
in_subset:
- nucleic acid sequence source
from_schema: https://w3id.org/mixs
keywords:
- material
- process
- sample
slot_uri: MIXS:0000016
alias: samp_mat_process
owner: MisagWastewaterSludge
domain_of:
- MigsBa
- MigsEu
- MigsOrg
- MigsPl
- MigsVi
- Mimag
- MimarksC
- MimarksS
- Mims
- Misag
- Miuvig
- Agriculture
range: string
recommended: true
sim_search_meth:
name: sim_search_meth
description: Tool used to compare ORFs with database, along with version and cutoffs
used
title: similarity search method
examples:
- value: HMMER3;3.1b2;hmmsearch, cutoff of 50 on score
in_subset:
- sequencing
from_schema: https://w3id.org/mixs
keywords:
- method
slot_uri: MIXS:0000063
alias: sim_search_meth
owner: MisagWastewaterSludge
domain_of:
- MigsBa
- MigsEu
- MigsOrg
- MigsPl
- MigsVi
- Mimag
- Mims
- Misag
- Miuvig
range: string
structured_pattern:
syntax: ^{software};{version};{parameters}$
interpolated: true
partial_match: true
depth:
name: depth
annotations:
Preferred_unit:
tag: Preferred_unit
value: meter
description: The vertical distance below local surface. For sediment or soil samples
depth is measured from sediment or soil surface, respectively. Depth can be
reported as an interval for subsurface samples
title: depth
examples:
- value: 10 meter
in_subset:
- environment
from_schema: https://w3id.org/mixs
keywords:
- depth
slot_uri: MIXS:0000018
alias: depth
owner: MisagWastewaterSludge
domain_of:
- MigsBa
- MigsEu
- MigsOrg
- MigsPl
- MigsVi
- Mimag
- MimarksC
- MimarksS
- Mims
- Misag
- Miuvig
- Agriculture
- FoodFarmEnvironment
- HostAssociated
- MicrobialMatBiofilm
- MiscellaneousNaturalOrArtificialEnvironment
- PlantAssociated
- Sediment
- Soil
- SymbiontAssociated
- WastewaterSludge
- Water
range: string
recommended: true
structured_pattern:
syntax: ^{scientific_float}( *- *{scientific_float})? *{text}$
interpolated: true
partial_match: true
samp_collect_method:
name: samp_collect_method
description: The method employed for collecting the sample
title: sample collection method
examples:
- value: swabbing
in_subset:
- nucleic acid sequence source
from_schema: https://w3id.org/mixs
keywords:
- method
- sample
slot_uri: MIXS:0001225
alias: samp_collect_method
owner: MisagWastewaterSludge
domain_of:
- MigsBa
- MigsEu
- MigsOrg
- MigsPl
- MigsVi
- Mimag
- MimarksC
- MimarksS
- Mims
- Misag
- Miuvig
- Agriculture
- FoodAnimalAndAnimalFeed
- FoodFoodProductionFacility
- FoodHumanFoods
range: string
recommended: true
structured_pattern:
syntax: ^{PMID}|{DOI}|{URL}|{text}$
interpolated: true
partial_match: true
wga_amp_appr:
name: wga_amp_appr
description: Method used to amplify genomic DNA in preparation for sequencing
title: WGA amplification approach
examples:
- value: mda based
in_subset:
- sequencing
from_schema: https://w3id.org/mixs
slot_uri: MIXS:0000055
alias: wga_amp_appr
owner: MisagWastewaterSludge
domain_of:
- Misag
- Miuvig
range: WgaAmpApprEnum
required: true
compl_appr:
name: compl_appr
annotations:
Expected_value:
tag: Expected_value
value: text
description: The approach used to determine the completeness of a given genomic
assembly, which would typically make use of a set of conserved marker genes
or a closely related reference genome. For UViG completeness, include reference
genome or group used, and contig feature suggesting a complete genome
title: completeness approach
examples:
- value: other
description: was other <colon> UViG length compared to the average length of
reference genomes from the P22virus genus (NCBI RefSeq v83)
in_subset:
- sequencing
from_schema: https://w3id.org/mixs
slot_uri: MIXS:0000071
alias: compl_appr
owner: MisagWastewaterSludge
domain_of:
- Mimag
- Misag
- Miuvig
range: ComplApprEnum
env_medium:
name: env_medium
description: 'Report the environmental material(s) immediately surrounding the
sample or specimen at the time of sampling. We recommend using subclasses of
''environmental material'' (http://purl.obolibrary.org/obo/ENVO_00010483). EnvO
documentation about how to use the field: https://github.com/EnvironmentOntology/envo/wiki/Using-ENVO-with-MIxS
. Terms from other OBO ontologies are permissible as long as they reference
mass/volume nouns (e.g. air, water, blood) and not discrete, countable entities
(e.g. a tree, a leaf, a table top)'
title: environmental medium
examples:
- value: bluegrass field soil [ENVO:00005789]
in_subset:
- environment
from_schema: https://w3id.org/mixs
keywords:
- environmental
slot_uri: MIXS:0000014
alias: env_medium
owner: MisagWastewaterSludge
domain_of:
- MigsBa
- MigsEu
- MigsOrg
- MigsPl
- MigsVi
- Mimag
- MimarksC
- MimarksS
- Mims
- Misag
- Miuvig
range: string
required: true
structured_pattern:
syntax: ^{termLabel} \[{termID}\]$
interpolated: true
partial_match: true
samp_taxon_id:
name: samp_taxon_id
description: NCBI taxon id of the sample. Maybe be a single taxon or mixed taxa
sample. Use 'synthetic metagenome for mock community/positive controls, or
'blank sample' for negative controls
title: taxonomy ID of DNA sample
examples:
- value: Gut Metagenome [NCBITaxon:749906]
in_subset:
- investigation
from_schema: https://w3id.org/mixs
keywords:
- dna
- identifier
- sample
- taxon
slot_uri: MIXS:0001320
alias: samp_taxon_id
owner: MisagWastewaterSludge
domain_of:
- MigsBa
- MigsEu
- MigsOrg
- MigsPl
- MigsVi
- Mimag
- MimarksC
- MimarksS
- Mims
- Misag
- Miuvig
range: string
required: true
structured_pattern:
syntax: ^{text} \[{NCBItaxon_id}\]$
interpolated: true
partial_match: true
geo_loc_name:
name: geo_loc_name
description: The geographical origin of the sample as defined by the country or
sea name followed by specific region name. Country or sea names should be chosen
from the INSDC country list (http://insdc.org/country.html), or the GAZ ontology
(http://purl.bioontology.org/ontology/GAZ)
title: geographic location (country and/or sea,region)
examples:
- value: 'USA: Maryland, Bethesda'
in_subset:
- environment
from_schema: https://w3id.org/mixs
keywords:
- geographic
- location
slot_uri: MIXS:0000010
alias: geo_loc_name
owner: MisagWastewaterSludge
domain_of:
- MigsBa
- MigsEu
- MigsOrg
- MigsPl
- MigsVi
- Mimag
- MimarksC
- MimarksS
- Mims
- Misag
- Miuvig
- FoodAnimalAndAnimalFeed
- FoodFarmEnvironment
- FoodFoodProductionFacility
- FoodHumanFoods
- SymbiontAssociated
range: string
required: true
structured_pattern:
syntax: '^{country}: {region}, {specific_location}$'
interpolated: true
partial_match: true
sc_lysis_approach:
name: sc_lysis_approach
description: Method used to free DNA from interior of the cell(s) or particle(s)
title: single cell or viral particle lysis approach
examples:
- value: enzymatic
in_subset:
- sequencing
from_schema: https://w3id.org/mixs
keywords:
- particle
- single
slot_uri: MIXS:0000076
alias: sc_lysis_approach
owner: MisagWastewaterSludge
domain_of:
- Misag
- Miuvig
range: ScLysisApproachEnum
required: true
collection_date:
name: collection_date
description: 'The time of sampling, either as an instance (single point in time)
or interval. In case no exact time is available, the date/time can be right
truncated i.e. all of these are valid times: 2008-01-23T19:23:10+00:00; 2008-01-23T19:23:10;
2008-01-23; 2008-01; 2008; Except: 2008-01; 2008 all are ISO8601 compliant'
title: collection date
examples:
- value: '2013-03-25T12:42:31+01:00'
in_subset:
- environment
from_schema: https://w3id.org/mixs
keywords:
- date
slot_uri: MIXS:0000011
alias: collection_date
owner: MisagWastewaterSludge
domain_of:
- MigsBa
- MigsEu
- MigsOrg
- MigsPl
- MigsVi
- Mimag
- MimarksC
- MimarksS
- Mims
- Misag
- Miuvig
- FoodAnimalAndAnimalFeed
- FoodFarmEnvironment
- FoodFoodProductionFacility
- FoodHumanFoods
- SymbiontAssociated
range: datetime
required: true
seq_meth:
name: seq_meth
description: Sequencing machine used. Where possible the term should be taken
from the OBI list of DNA sequencers (http://purl.obolibrary.org/obo/OBI_0400103)
title: sequencing method
examples:
- value: 454 Genome Sequencer FLX [OBI:0000702]
in_subset:
- sequencing
from_schema: https://w3id.org/mixs
keywords:
- method
slot_uri: MIXS:0000050
alias: seq_meth
owner: MisagWastewaterSludge
domain_of:
- MigsBa
- MigsEu
- MigsOrg
- MigsPl
- MigsVi
- Mimag
- MimarksC
- MimarksS
- Mims
- Misag
- Miuvig
- Agriculture
- FoodAnimalAndAnimalFeed
- FoodFarmEnvironment
- FoodFoodProductionFacility
- FoodHumanFoods
range: string
required: true
structured_pattern:
syntax: ^{text}|({termLabel} \[{termID}\])$
interpolated: true
partial_match: true
lat_lon:
name: lat_lon
description: The geographical origin of the sample as defined by latitude and
longitude. The values should be reported in decimal degrees, limited to 8 decimal
points, and in WGS84 system
title: geographic location (latitude and longitude)
examples:
- value: 50.586825 6.408977
in_subset:
- environment
from_schema: https://w3id.org/mixs
keywords:
- geographic
- location
slot_uri: MIXS:0000009
alias: lat_lon
owner: MisagWastewaterSludge
domain_of:
- MigsBa
- MigsEu
- MigsOrg
- MigsPl
- MigsVi
- Mimag
- MimarksC
- MimarksS
- Mims
- Misag
- Miuvig
- FoodAnimalAndAnimalFeed
- FoodFarmEnvironment
- FoodFoodProductionFacility
- FoodHumanFoods
- SymbiontAssociated
range: string
required: true
structured_pattern:
syntax: ^{lat} {lon}$
interpolated: true
partial_match: true
elev:
name: elev
annotations:
Preferred_unit:
tag: Preferred_unit
value: meter
description: Elevation of the sampling site is its height above a fixed reference
point, most commonly the mean sea level. Elevation is mainly used when referring
to points on the earth's surface, while altitude is used for points above the
surface, such as an aircraft in flight or a spacecraft in orbit
title: elevation
examples:
- value: 100 meter
in_subset:
- environment
from_schema: https://w3id.org/mixs
keywords:
- elevation
slot_uri: MIXS:0000093
alias: elev
owner: MisagWastewaterSludge
domain_of:
- MigsBa
- MigsEu
- MigsOrg
- MigsPl
- MigsVi
- Mimag
- MimarksC
- MimarksS
- Mims
- Misag
- Miuvig
- Agriculture
- Air
- HostAssociated
- HydrocarbonResourcesCores
- MicrobialMatBiofilm
- MiscellaneousNaturalOrArtificialEnvironment
- PlantAssociated
- Sediment
- Soil
- SymbiontAssociated
- Water
range: string
recommended: true
structured_pattern:
syntax: ^{scientific_float}( *- *{scientific_float})? *{text}$
interpolated: true
partial_match: true
env_broad_scale:
name: env_broad_scale
description: 'Report the major environmental system the sample or specimen came
from. The system(s) identified should have a coarse spatial grain, to provide
the general environmental context of where the sampling was done (e.g. in the
desert or a rainforest). We recommend using subclasses of EnvO s biome class: http://purl.obolibrary.org/obo/ENVO_00000428.
EnvO documentation about how to use the field: https://github.com/EnvironmentOntology/envo/wiki/Using-ENVO-with-MIxS'
title: broad-scale environmental context
examples:
- value: rangeland biome [ENVO:01000247]
in_subset:
- environment
from_schema: https://w3id.org/mixs
keywords:
- context
- environmental
slot_uri: MIXS:0000012
alias: env_broad_scale
owner: MisagWastewaterSludge
domain_of:
- MigsBa
- MigsEu
- MigsOrg
- MigsPl
- MigsVi
- Mimag
- MimarksC
- MimarksS
- Mims
- Misag
- Miuvig
range: string
required: true
structured_pattern:
syntax: ^{termLabel} \[{termID}\]$
interpolated: true
partial_match: true
tax_class:
name: tax_class
description: Method used for taxonomic classification, along with reference database
used, classification rank, and thresholds used to classify new genomes
title: taxonomic classification
examples:
- value: vConTACT vContact2 (references from NCBI RefSeq v83, genus rank classification,
default parameters)
in_subset:
- sequencing
from_schema: https://w3id.org/mixs
keywords:
- classification
- taxon
slot_uri: MIXS:0000064
alias: tax_class
owner: MisagWastewaterSludge
domain_of:
- MigsBa
- MigsEu
- MigsOrg
- MigsPl
- MigsVi
- Mimag
- Mims
- Misag
- Miuvig
range: string
experimental_factor:
name: experimental_factor
annotations:
Expected_value:
tag: Expected_value
value: text or EFO and/or OBI
description: Variable aspects of an experiment design that can be used to describe
an experiment, or set of experiments, in an increasingly detailed manner. This
field accepts ontology terms from Experimental Factor Ontology (EFO) and/or
Ontology for Biomedical Investigations (OBI)
title: experimental factor
examples:
- value: time series design [EFO:0001779]
in_subset:
- investigation
from_schema: https://w3id.org/mixs
keywords:
- experimental
- factor
string_serialization: '{termLabel} [{termID}]|{text}'
slot_uri: MIXS:0000008
alias: experimental_factor
owner: MisagWastewaterSludge
domain_of:
- MigsBa
- MigsEu
- MigsOrg
- MigsPl
- MigsVi
- Mimag
- MimarksC
- MimarksS
- Mims
- Misag
- Miuvig
- FoodAnimalAndAnimalFeed
- FoodFoodProductionFacility
- FoodHumanFoods
range: string
recommended: true
multivalued: true
pattern: ^\S+.*\S+ \[[a-zA-Z]{2,}:\d+\]$
associated_resource:
name: associated_resource
annotations:
Expected_value:
tag: Expected_value
value: reference to resource
description: A related resource that is referenced, cited, or otherwise associated
to the sequence
title: relevant electronic resources
examples:
- value: http://www.earthmicrobiome.org/
in_subset:
- sequencing
from_schema: https://w3id.org/mixs
keywords:
- resource
slot_uri: MIXS:0000091
alias: associated_resource
owner: MisagWastewaterSludge
domain_of:
- MigsBa
- MigsEu
- MigsOrg
- MigsPl
- MigsVi
- Mimag
- MimarksC
- MimarksS
- Mims
- Misag
- Miuvig
- Agriculture
range: string
recommended: true
multivalued: true
structured_pattern:
syntax: ^{PMID}|{DOI}|{URL}$
interpolated: true
sop:
name: sop
annotations:
Expected_value:
tag: Expected_value
value: reference to SOP
description: Standard operating procedures used in assembly and/or annotation
of genomes, metagenomes or environmental sequences
title: relevant standard operating procedures
examples:
- value: http://press.igsb.anl.gov/earthmicrobiome/protocols-and-standards/its/
in_subset:
- sequencing
from_schema: https://w3id.org/mixs
keywords:
- procedures
slot_uri: MIXS:0000090
alias: sop
owner: MisagWastewaterSludge
domain_of:
- MigsBa
- MigsEu
- MigsOrg
- MigsPl
- MigsVi
- Mimag
- MimarksC
- MimarksS
- Mims
- Misag
- Miuvig
- Agriculture
range: string
recommended: true
multivalued: true
structured_pattern:
syntax: ^{PMID}|{DOI}|{URL}$
interpolated: true
alkalinity:
name: alkalinity
annotations:
Preferred_unit:
tag: Preferred_unit
value: milliequivalent per liter, milligram per liter
description: Alkalinity, the ability of a solution to neutralize acids to the
equivalence point of carbonate or bicarbonate
title: alkalinity
examples:
- value: 50 milligram per liter
from_schema: https://w3id.org/mixs
keywords:
- alkalinity
slot_uri: MIXS:0000421
alias: alkalinity
owner: MisagWastewaterSludge
domain_of:
- HydrocarbonResourcesCores
- HydrocarbonResourcesFluidsSwabs
- MicrobialMatBiofilm
- MiscellaneousNaturalOrArtificialEnvironment
- Sediment
- WastewaterSludge
- Water
range: string
structured_pattern:
syntax: ^{scientific_float}( *- *{scientific_float})? *{text}$
interpolated: true
partial_match: true
biochem_oxygen_dem:
name: biochem_oxygen_dem
annotations:
Preferred_unit:
tag: Preferred_unit
value: milligram per liter
description: Amount of dissolved oxygen needed by aerobic biological organisms
in a body of water to break down organic material present in a given water sample
at certain temperature over a specific time period
title: biochemical oxygen demand
from_schema: https://w3id.org/mixs
keywords:
- oxygen
slot_uri: MIXS:0000653
alias: biochem_oxygen_dem
owner: MisagWastewaterSludge
domain_of:
- WastewaterSludge
range: string
structured_pattern:
syntax: ^{scientific_float}( *- *{scientific_float})? *{text}$
interpolated: true
partial_match: true
chem_administration:
name: chem_administration
annotations:
Expected_value:
tag: Expected_value
value: CHEBI;timestamp
description: List of chemical compounds administered to the host or site where
sampling occurred, and when (e.g. Antibiotics, n fertilizer, air filter); can
include multiple compounds. For chemical entities of biological interest ontology
(chebi) (v 163), http://purl.bioontology.org/ontology/chebi
title: chemical administration
examples:
- value: agar [CHEBI:2509];2018-05-11T20:00Z
from_schema: https://w3id.org/mixs
keywords:
- administration
string_serialization: '{termLabel} [{termID}];{timestamp}'
slot_uri: MIXS:0000751
alias: chem_administration
owner: MisagWastewaterSludge
domain_of:
- Agriculture
- Air
- FoodFarmEnvironment
- HostAssociated
- HumanAssociated
- HumanGut
- HumanOral
- HumanSkin
- HumanVaginal
- MicrobialMatBiofilm
- MiscellaneousNaturalOrArtificialEnvironment
- PlantAssociated
- Sediment
- SymbiontAssociated
- WastewaterSludge
- Water
range: string
multivalued: true
chem_oxygen_dem:
name: chem_oxygen_dem
annotations:
Preferred_unit:
tag: Preferred_unit
value: milligram per liter
description: A measure of the capacity of water to consume oxygen during the decomposition
of organic matter and the oxidation of inorganic chemicals such as ammonia and
nitrite
title: chemical oxygen demand
from_schema: https://w3id.org/mixs
keywords:
- oxygen
slot_uri: MIXS:0000656
alias: chem_oxygen_dem
owner: MisagWastewaterSludge
domain_of:
- WastewaterSludge
range: string
structured_pattern:
syntax: ^{scientific_float}( *- *{scientific_float})? *{text}$
interpolated: true
partial_match: true
efficiency_percent:
name: efficiency_percent
annotations:
Preferred_unit:
tag: Preferred_unit
value: micromole per liter
description: Percentage of volatile solids removed from the anaerobic digestor
title: efficiency percent
from_schema: https://w3id.org/mixs
keywords:
- percent
slot_uri: MIXS:0000657
alias: efficiency_percent
owner: MisagWastewaterSludge
domain_of:
- WastewaterSludge
range: string
structured_pattern:
syntax: ^{scientific_float}( *- *{scientific_float})? *{text}$
interpolated: true
partial_match: true
emulsions:
name: emulsions
annotations:
Expected_value:
tag: Expected_value
value: emulsion name;measurement value
Preferred_unit:
tag: Preferred_unit
value: gram per liter
description: Amount or concentration of substances such as paints, adhesives,
mayonnaise, hair colorants, emulsified oils, etc.; can include multiple emulsion
types
title: emulsions
from_schema: https://w3id.org/mixs
string_serialization: '{text};{float} {unit}'
slot_uri: MIXS:0000660
alias: emulsions
owner: MisagWastewaterSludge
domain_of:
- WastewaterSludge
range: string
multivalued: true
gaseous_substances:
name: gaseous_substances
annotations:
Expected_value:
tag: Expected_value
value: gaseous substance name;measurement value
Preferred_unit:
tag: Preferred_unit
value: micromole per liter
description: Amount or concentration of substances such as hydrogen sulfide, carbon
dioxide, methane, etc.; can include multiple substances
title: gaseous substances
from_schema: https://w3id.org/mixs
string_serialization: '{text};{float} {unit}'
slot_uri: MIXS:0000661
alias: gaseous_substances
owner: MisagWastewaterSludge
domain_of:
- WastewaterSludge
range: string
multivalued: true
indust_eff_percent:
name: indust_eff_percent
annotations:
Preferred_unit:
tag: Preferred_unit
value: percentage
description: Percentage of industrial effluents received by wastewater treatment
plant
title: industrial effluent percent
from_schema: https://w3id.org/mixs
keywords:
- percent
slot_uri: MIXS:0000662
alias: indust_eff_percent
owner: MisagWastewaterSludge
domain_of:
- WastewaterSludge
range: string
structured_pattern:
syntax: ^{scientific_float}( *- *{scientific_float})? *{text}$
interpolated: true
partial_match: true
inorg_particles:
name: inorg_particles
annotations:
Expected_value:
tag: Expected_value
value: inorganic particle name;measurement value
Preferred_unit:
tag: Preferred_unit
value: mole per liter, milligram per liter
description: Concentration of particles such as sand, grit, metal particles, ceramics,
etc.; can include multiple particles
title: inorganic particles
from_schema: https://w3id.org/mixs
keywords:
- inorganic
- particle
string_serialization: '{text};{float} {unit}'
slot_uri: MIXS:0000664
alias: inorg_particles
owner: MisagWastewaterSludge
domain_of:
- WastewaterSludge
range: string
multivalued: true
misc_param:
name: misc_param
annotations:
Expected_value:
tag: Expected_value
value: parameter name;measurement value
description: Any other measurement performed or parameter collected, that is not
listed here
title: miscellaneous parameter
examples:
- value: Bicarbonate ion concentration;2075 micromole per kilogram
from_schema: https://w3id.org/mixs
keywords:
- parameter
string_serialization: '{text};{float} {unit}'
slot_uri: MIXS:0000752
alias: misc_param
owner: MisagWastewaterSludge
domain_of:
- Agriculture
- Air
- FoodAnimalAndAnimalFeed
- FoodFarmEnvironment
- FoodFoodProductionFacility
- FoodHumanFoods
- HostAssociated
- HumanAssociated
- HumanGut
- HumanOral
- HumanSkin
- HumanVaginal
- HydrocarbonResourcesCores
- HydrocarbonResourcesFluidsSwabs
- MicrobialMatBiofilm
- MiscellaneousNaturalOrArtificialEnvironment
- PlantAssociated
- Sediment
- Soil
- SymbiontAssociated
- WastewaterSludge
- Water
range: string
multivalued: true
nitrate:
name: nitrate
annotations:
Preferred_unit:
tag: Preferred_unit
value: micromole per liter, milligram per liter, parts per million
description: Concentration of nitrate in the sample
title: nitrate
examples:
- value: 65 micromole per liter
from_schema: https://w3id.org/mixs
keywords:
- nitrate
slot_uri: MIXS:0000425
alias: nitrate
owner: MisagWastewaterSludge
domain_of:
- HydrocarbonResourcesCores
- HydrocarbonResourcesFluidsSwabs
- MicrobialMatBiofilm
- MiscellaneousNaturalOrArtificialEnvironment
- Sediment
- WastewaterSludge
- Water
range: string
structured_pattern:
syntax: ^{scientific_float}( *- *{scientific_float})? *{text}$
interpolated: true
partial_match: true
org_particles:
name: org_particles
annotations:
Expected_value:
tag: Expected_value
value: particle name;measurement value
Preferred_unit:
tag: Preferred_unit
value: gram per liter
description: Concentration of particles such as faeces, hairs, food, vomit, paper
fibers, plant material, humus, etc
title: organic particles
from_schema: https://w3id.org/mixs
keywords:
- organic
- particle
string_serialization: '{text};{float} {unit}'
slot_uri: MIXS:0000665
alias: org_particles
owner: MisagWastewaterSludge
domain_of:
- WastewaterSludge
range: string
multivalued: true
organism_count:
name: organism_count
annotations:
Expected_value:
tag: Expected_value
value: organism name;measurement value;enumeration
description: 'Total cell count of any organism (or group of organisms) per gram,
volume or area of sample, should include name of organism followed by count.
The method that was used for the enumeration (e.g. qPCR, atp, mpn, etc.) Should
also be provided. (example: total prokaryotes; 3.5e7 cells per ml; qpcr)'
title: organism count
examples:
- value: total prokaryotes;3.5e7 cells per milliliter;qPCR
from_schema: https://w3id.org/mixs
keywords:
- count
- organism
string_serialization: '{text};{float} {unit};[ATP|MPN|qPCR|other]'
slot_uri: MIXS:0000103
alias: organism_count
owner: MisagWastewaterSludge
domain_of:
- Agriculture
- Air
- BuiltEnvironment
- FoodAnimalAndAnimalFeed
- FoodFarmEnvironment
- FoodFoodProductionFacility
- FoodHumanFoods
- HostAssociated
- HumanAssociated
- HumanGut
- HumanOral
- HumanSkin
- HumanVaginal
- HydrocarbonResourcesCores
- HydrocarbonResourcesFluidsSwabs
- MicrobialMatBiofilm
- MiscellaneousNaturalOrArtificialEnvironment
- PlantAssociated
- Sediment
- SymbiontAssociated
- WastewaterSludge
- Water
range: string
multivalued: true
oxy_stat_samp:
name: oxy_stat_samp
description: Oxygenation status of sample
title: oxygenation status of sample
examples:
- value: aerobic
from_schema: https://w3id.org/mixs
keywords:
- oxygen
- sample
- status
slot_uri: MIXS:0000753
alias: oxy_stat_samp
owner: MisagWastewaterSludge
domain_of:
- Agriculture
- Air
- HostAssociated
- HumanAssociated
- HumanGut
- HumanOral
- HumanSkin
- HumanVaginal
- HydrocarbonResourcesCores
- HydrocarbonResourcesFluidsSwabs
- MicrobialMatBiofilm
- MiscellaneousNaturalOrArtificialEnvironment
- PlantAssociated
- Sediment
- SymbiontAssociated
- WastewaterSludge
- Water
range: OxyStatSampEnum
ph:
name: ph
description: pH measurement of the sample, or liquid portion of sample, or aqueous
phase of the fluid
title: pH
examples:
- value: '7.2'
from_schema: https://w3id.org/mixs
keywords:
- ph
slot_uri: MIXS:0001001
alias: ph
owner: MisagWastewaterSludge
domain_of:
- FoodFarmEnvironment
- HydrocarbonResourcesCores
- HydrocarbonResourcesFluidsSwabs
- MicrobialMatBiofilm
- MiscellaneousNaturalOrArtificialEnvironment
- Sediment
- Soil
- WastewaterSludge
- Water
range: float
perturbation:
name: perturbation
annotations:
Expected_value:
tag: Expected_value
value: perturbation type name;perturbation interval and duration
description: Type of perturbation, e.g. chemical administration, physical disturbance,
etc., coupled with perturbation regimen including how many times the perturbation
was repeated, how long each perturbation lasted, and the start and end time
of the entire perturbation period; can include multiple perturbation types
title: perturbation
examples:
- value: antibiotic addition;R2/2018-05-11T14:30Z/2018-05-11T19:30Z/P1H30M
from_schema: https://w3id.org/mixs
keywords:
- perturbation
string_serialization: '{text};{Rn/start_time/end_time/duration}'
slot_uri: MIXS:0000754
alias: perturbation
owner: MisagWastewaterSludge
domain_of:
- Agriculture
- Air
- FoodAnimalAndAnimalFeed
- FoodFarmEnvironment
- FoodHumanFoods
- HostAssociated
- HumanAssociated
- HumanGut
- HumanOral
- HumanSkin
- HumanVaginal
- MicrobialMatBiofilm
- MiscellaneousNaturalOrArtificialEnvironment
- PlantAssociated
- Sediment
- SymbiontAssociated
- WastewaterSludge
- Water
range: string
multivalued: true
phosphate:
name: phosphate
annotations:
Preferred_unit:
tag: Preferred_unit
value: micromole per liter
description: Concentration of phosphate
title: phosphate
examples:
- value: 0.7 micromole per liter
from_schema: https://w3id.org/mixs
keywords:
- phosphate
slot_uri: MIXS:0000505
alias: phosphate
owner: MisagWastewaterSludge
domain_of:
- MicrobialMatBiofilm
- MiscellaneousNaturalOrArtificialEnvironment
- Sediment
- WastewaterSludge
- Water
range: string
structured_pattern:
syntax: ^{scientific_float}( *- *{scientific_float})? *{text}$
interpolated: true
partial_match: true
pre_treatment:
name: pre_treatment
annotations:
Expected_value:
tag: Expected_value
value: pre-treatment type
description: The process of pre-treatment removes materials that can be easily
collected from the raw wastewater
title: pre-treatment
from_schema: https://w3id.org/mixs
slot_uri: MIXS:0000348
alias: pre_treatment
owner: MisagWastewaterSludge
domain_of:
- WastewaterSludge
range: string
primary_treatment:
name: primary_treatment
annotations:
Expected_value:
tag: Expected_value
value: primary treatment type
description: The process to produce both a generally homogeneous liquid capable
of being treated biologically and a sludge that can be separately treated or
processed
title: primary treatment
from_schema: https://w3id.org/mixs
keywords:
- primary
- treatment
slot_uri: MIXS:0000349
alias: primary_treatment
owner: MisagWastewaterSludge
domain_of:
- WastewaterSludge
range: string
reactor_type:
name: reactor_type
annotations:
Expected_value:
tag: Expected_value
value: reactor type name
description: Anaerobic digesters can be designed and engineered to operate using
a number of different process configurations, as batch or continuous, mesophilic,
high solid or low solid, and single stage or multistage
title: reactor type
from_schema: https://w3id.org/mixs
keywords:
- type
slot_uri: MIXS:0000350
alias: reactor_type
owner: MisagWastewaterSludge
domain_of:
- WastewaterSludge
range: string
salinity:
name: salinity
annotations:
Preferred_unit:
tag: Preferred_unit
value: practical salinity unit, percentage
description: The total concentration of all dissolved salts in a liquid or solid
sample. While salinity can be measured by a complete chemical analysis, this
method is difficult and time consuming. More often, it is instead derived from
the conductivity measurement. This is known as practical salinity. These derivations
compare the specific conductance of the sample to a salinity standard such as
seawater
title: salinity
examples:
- value: 25 practical salinity unit
from_schema: https://w3id.org/mixs
keywords:
- salinity
slot_uri: MIXS:0000183
alias: salinity
owner: MisagWastewaterSludge
domain_of:
- Air
- FoodFarmEnvironment
- HostAssociated
- HumanAssociated
- HumanGut
- HumanOral
- HumanSkin
- HumanVaginal
- HydrocarbonResourcesCores
- HydrocarbonResourcesFluidsSwabs
- MicrobialMatBiofilm
- MiscellaneousNaturalOrArtificialEnvironment
- PlantAssociated
- Sediment
- SymbiontAssociated
- WastewaterSludge
- Water
range: string
structured_pattern:
syntax: ^{scientific_float}( *- *{scientific_float})? *{text}$
interpolated: true
partial_match: true
samp_store_dur:
name: samp_store_dur
description: Duration for which the sample was stored. Indicate the duration for
which the sample was stored written in ISO 8601 format
title: sample storage duration
examples:
- value: P1Y6M
from_schema: https://w3id.org/mixs
keywords:
- duration
- period
- sample
- storage
slot_uri: MIXS:0000116
alias: samp_store_dur
owner: MisagWastewaterSludge
domain_of:
- Agriculture
- Air
- FoodAnimalAndAnimalFeed
- FoodFarmEnvironment
- FoodFoodProductionFacility
- FoodHumanFoods
- HostAssociated
- HumanAssociated
- HumanGut
- HumanOral
- HumanSkin
- HumanVaginal
- HydrocarbonResourcesCores
- HydrocarbonResourcesFluidsSwabs
- MicrobialMatBiofilm
- MiscellaneousNaturalOrArtificialEnvironment
- PlantAssociated
- Sediment
- SymbiontAssociated
- WastewaterSludge
- Water
range: string
structured_pattern:
syntax: ^{duration}$
interpolated: true
partial_match: true
samp_store_loc:
name: samp_store_loc
annotations:
Expected_value:
tag: Expected_value
value: location name
description: Location at which sample was stored, usually name of a specific freezer/room
title: sample storage location
examples:
- value: Freezer no:5
from_schema: https://w3id.org/mixs
keywords:
- location
- sample
- storage
slot_uri: MIXS:0000755
alias: samp_store_loc
owner: MisagWastewaterSludge
domain_of:
- Agriculture
- Air
- FoodAnimalAndAnimalFeed
- FoodFoodProductionFacility
- FoodHumanFoods
- HostAssociated
- HumanAssociated
- HumanGut
- HumanOral
- HumanSkin
- HumanVaginal
- HydrocarbonResourcesCores
- HydrocarbonResourcesFluidsSwabs
- MicrobialMatBiofilm
- MiscellaneousNaturalOrArtificialEnvironment
- PlantAssociated
- Sediment
- SymbiontAssociated
- WastewaterSludge
- Water
range: string
samp_store_temp:
name: samp_store_temp
annotations:
Preferred_unit:
tag: Preferred_unit
value: degree Celsius
description: Temperature at which sample was stored, e.g. -80 degree Celsius
title: sample storage temperature
examples:
- value: -80 degree Celsius
from_schema: https://w3id.org/mixs
keywords:
- sample
- storage
- temperature
slot_uri: MIXS:0000110
alias: samp_store_temp
owner: MisagWastewaterSludge
domain_of:
- Agriculture
- Air
- FoodAnimalAndAnimalFeed
- FoodFarmEnvironment
- FoodFoodProductionFacility
- FoodHumanFoods
- HostAssociated
- HumanAssociated
- HumanGut
- HumanOral
- HumanSkin
- HumanVaginal
- HydrocarbonResourcesCores
- HydrocarbonResourcesFluidsSwabs
- MicrobialMatBiofilm
- MiscellaneousNaturalOrArtificialEnvironment
- PlantAssociated
- Sediment
- SymbiontAssociated
- WastewaterSludge
- Water
range: string
structured_pattern:
syntax: ^{scientific_float}( *- *{scientific_float})? *{text}$
interpolated: true
partial_match: true
secondary_treatment:
name: secondary_treatment
annotations:
Expected_value:
tag: Expected_value
value: secondary treatment type
description: The process for substantially degrading the biological content of
the sewage
title: secondary treatment
from_schema: https://w3id.org/mixs
keywords:
- secondary
- treatment
slot_uri: MIXS:0000351
alias: secondary_treatment
owner: MisagWastewaterSludge
domain_of:
- WastewaterSludge
range: string
sewage_type:
name: sewage_type
annotations:
Expected_value:
tag: Expected_value
value: sewage type name
description: Type of wastewater treatment plant as municipial or industrial
title: sewage type
from_schema: https://w3id.org/mixs
keywords:
- type
slot_uri: MIXS:0000215
alias: sewage_type
owner: MisagWastewaterSludge
domain_of:
- WastewaterSludge
range: string
sludge_retent_time:
name: sludge_retent_time
annotations:
Preferred_unit:
tag: Preferred_unit
value: hours
description: The time activated sludge remains in reactor
title: sludge retention time
from_schema: https://w3id.org/mixs
keywords:
- time
slot_uri: MIXS:0000669
alias: sludge_retent_time
owner: MisagWastewaterSludge
domain_of:
- WastewaterSludge
range: string
structured_pattern:
syntax: ^{scientific_float}( *- *{scientific_float})? *{text}$
interpolated: true
partial_match: true
sodium:
name: sodium
annotations:
Preferred_unit:
tag: Preferred_unit
value: milligram per liter, parts per million
description: Sodium concentration in the sample
title: sodium
examples:
- value: 10.5 milligram per liter
from_schema: https://w3id.org/mixs
slot_uri: MIXS:0000428
alias: sodium
owner: MisagWastewaterSludge
domain_of:
- HydrocarbonResourcesCores
- HydrocarbonResourcesFluidsSwabs
- MicrobialMatBiofilm
- MiscellaneousNaturalOrArtificialEnvironment
- Sediment
- WastewaterSludge
- Water
range: string
structured_pattern:
syntax: ^{scientific_float}( *- *{scientific_float})? *{text}$
interpolated: true
partial_match: true
soluble_inorg_mat:
name: soluble_inorg_mat
annotations:
Expected_value:
tag: Expected_value
value: soluble inorganic material name;measurement value
Preferred_unit:
tag: Preferred_unit
value: gram, microgram, mole per liter, gram per liter, parts per million
description: Concentration of substances such as ammonia, road-salt, sea-salt,
cyanide, hydrogen sulfide, thiocyanates, thiosulfates, etc
title: soluble inorganic material
from_schema: https://w3id.org/mixs
keywords:
- inorganic
- material
- soluble
string_serialization: '{text};{float} {unit}'
slot_uri: MIXS:0000672
alias: soluble_inorg_mat
owner: MisagWastewaterSludge
domain_of:
- WastewaterSludge
range: string
multivalued: true
soluble_org_mat:
name: soluble_org_mat
annotations:
Expected_value:
tag: Expected_value
value: soluble organic material name;measurement value
Preferred_unit:
tag: Preferred_unit
value: gram, microgram, mole per liter, gram per liter, parts per million
description: Concentration of substances such as urea, fruit sugars, soluble proteins,
drugs, pharmaceuticals, etc
title: soluble organic material
from_schema: https://w3id.org/mixs
keywords:
- material
- organic
- soluble
string_serialization: '{text};{float} {unit}'
slot_uri: MIXS:0000673
alias: soluble_org_mat
owner: MisagWastewaterSludge
domain_of:
- WastewaterSludge
range: string
multivalued: true
suspend_solids:
name: suspend_solids
annotations:
Expected_value:
tag: Expected_value
value: suspended solid name;measurement value
Preferred_unit:
tag: Preferred_unit
value: gram, microgram, milligram per liter, mole per liter, gram per liter,
part per million
description: Concentration of substances including a wide variety of material,
such as silt, decaying plant and animal matter; can include multiple substances
title: suspended solids
from_schema: https://w3id.org/mixs
keywords:
- solids
- suspended
string_serialization: '{text};{float} {unit}'
slot_uri: MIXS:0000150
alias: suspend_solids
owner: MisagWastewaterSludge
domain_of:
- HydrocarbonResourcesCores
- HydrocarbonResourcesFluidsSwabs
- WastewaterSludge
range: string
multivalued: true
tertiary_treatment:
name: tertiary_treatment
annotations:
Expected_value:
tag: Expected_value
value: tertiary treatment type
description: The process providing a final treatment stage to raise the effluent
quality before it is discharged to the receiving environment
title: tertiary treatment
from_schema: https://w3id.org/mixs
keywords:
- treatment
slot_uri: MIXS:0000352
alias: tertiary_treatment
owner: MisagWastewaterSludge
domain_of:
- WastewaterSludge
range: string
tot_nitro:
name: tot_nitro
annotations:
Preferred_unit:
tag: Preferred_unit
value: microgram per liter, micromole per liter, milligram per liter
description: 'Total nitrogen concentration of water samples, calculated by: total
nitrogen = total dissolved nitrogen + particulate nitrogen. Can also be measured
without filtering, reported as nitrogen'
title: total nitrogen concentration
examples:
- value: 50 micromole per liter
from_schema: https://w3id.org/mixs
keywords:
- concentration
- nitrogen
- total
slot_uri: MIXS:0000102
alias: tot_nitro
owner: MisagWastewaterSludge
domain_of:
- HydrocarbonResourcesCores
- HydrocarbonResourcesFluidsSwabs
- WastewaterSludge
- Water
range: string
structured_pattern:
syntax: ^{scientific_float}( *- *{scientific_float})? *{text}$
interpolated: true
partial_match: true
tot_phosphate:
name: tot_phosphate
annotations:
Preferred_unit:
tag: Preferred_unit
value: microgram per liter, micromole per liter
description: Total amount or concentration of phosphate
title: total phosphate
from_schema: https://w3id.org/mixs
keywords:
- phosphate
- total
slot_uri: MIXS:0000689
alias: tot_phosphate
owner: MisagWastewaterSludge
domain_of:
- Agriculture
- WastewaterSludge
range: string
structured_pattern:
syntax: ^{scientific_float}( *- *{scientific_float})? *{text}$
interpolated: true
partial_match: true
wastewater_type:
name: wastewater_type
annotations:
Expected_value:
tag: Expected_value
value: wastewater type name
description: The origin of wastewater such as human waste, rainfall, storm drains,
etc
title: wastewater type
from_schema: https://w3id.org/mixs
keywords:
- type
slot_uri: MIXS:0000353
alias: wastewater_type
owner: MisagWastewaterSludge
domain_of:
- WastewaterSludge
range: string
class_uri: MIXS:0010010_0016013