Combination: MigsVi combined with HydrocarbonResourcesFluidsSwabs (MigsViHydrocarbonResourcesFluidsSwabs)
MIxS Data that comply with the MigsVi checklist and the HydrocarbonResourcesFluidsSwabs Extension
Composition
MigsVi [Checklist] + HydrocarbonResourcesFluidsSwabs [Extension]
Terms
| MIXS ID | Name | Cardinality and Range | Description |
|---|---|---|---|
| MIXS:0001107 | samp_name | 1 String |
A local identifier or name that for the material sample used for extracting n... |
| MIXS:0000043 | lib_screen | 0..1 String |
Specific enrichment or screening methods applied before and/or after creating... |
| MIXS:0000062 | ref_db | 0..1 String |
List of database(s) used for ORF annotation, along with version number and re... |
| MIXS:0000038 | nucl_acid_amp | 0..1 recommended String |
A link to a literature reference, electronic resource or a standard operating... |
| MIXS:0000039 | lib_size | 0..1 Integer |
Total number of clones in the library prepared for the project |
| MIXS:0000057 | assembly_name | 0..1 recommended String |
Name/version of the assembly provided by the submitter that is used in the ge... |
| MIXS:0000113 | temp | 1 recommended String |
Temperature of the sample at the time of sampling |
| MIXS:0000069 | compl_score | 0..1 String |
Completeness score is typically based on either the fraction of markers found... |
| MIXS:0000037 | nucl_acid_ext | 0..1 recommended String |
A link to a literature reference, electronic resource or a standard operating... |
| MIXS:0000001 | samp_size | 0..1 String |
The total amount or size (volume (ml), mass (g) or area (m2) ) of sample coll... |
| MIXS:0000003 | isol_growth_condt | 1 String |
Publication reference in the form of pubmed ID (pmid), digital object identif... |
| MIXS:0000094 | alt | 0..1 recommended String |
Heights of objects such as airplanes, space shuttles, rockets, atmospheric ba... |
| MIXS:0000026 | source_mat_id | * recommended String |
A unique identifier assigned to a material sample (as defined by http://rs |
| MIXS:0000024 | estimated_size | 0..1 String |
The estimated size of the genome prior to sequencing |
| MIXS:0000111 | samp_vol_we_dna_ext | 0..1 recommended String |
Volume (ml) or mass (g) of total collected sample processed for DNA extractio... |
| MIXS:0000027 | pathogenicity | 0..1 recommended String |
To what is the entity pathogenic |
| MIXS:0000040 | lib_reads_seqd | 0..1 Integer |
Total number of clones sequenced from the library |
| MIXS:0000034 | encoded_traits | 0..1 recommended String |
Should include key traits like antibiotic resistance or xenobiotic degradatio... |
| MIXS:0000033 | propagation | 1 String |
The type of reproduction from the parent stock |
| MIXS:0000002 | samp_collect_device | 0..1 String |
The device used to collect an environmental sample |
| MIXS:0000060 | number_contig | 0..1 Integer |
Total number of contigs in the cleaned/submitted assembly that makes up a giv... |
| MIXS:0000028 | biotic_relationship | 0..1 BioticRelationshipEnum |
Description of relationship(s) between the subject organism and other organis... |
| MIXS:0000022 | num_replicons | 0..1 recommended Integer |
Reports the number of replicons in a nuclear genome of eukaryotes, in the gen... |
| MIXS:0000041 | lib_layout | 0..1 LibLayoutEnum |
Specify whether to expect single, paired, or other configuration of reads |
| MIXS:0000056 | assembly_qual | 0..1 AssemblyQualEnum |
The assembly quality category is based on sets of criteria outlined for each ... |
| MIXS:0000025 | ref_biomaterial | 0..1 String |
Primary publication if isolated before genome publication; otherwise, primary... |
| MIXS:0000092 | project_name | 1 String |
Name of the project within which the sequencing was organized |
| MIXS:0000042 | lib_vector | 0..1 String |
Cloning vector type(s) used in construction of libraries |
| MIXS:0000030 | host_spec_range | * recommended String |
The range and diversity of host species that an organism is capable of infect... |
| MIXS:0001321 | neg_cont_type | 0..1 recommended NegContTypeEnum |
The substance or equipment used as a negative control in an investigation |
| MIXS:0000036 | virus_enrich_appr | 0..1 recommended VirusEnrichApprEnum |
List of approaches used to enrich the sample for viruses, if any |
| MIXS:0000048 | adapters | 0..1 recommended String |
Adapters provide priming sequences for both amplification and sequencing of t... |
| MIXS:0000058 | assembly_software | 1 String |
Tool(s) used for assembly, including version number and parameters |
| MIXS:0000053 | tax_ident | 0..1 recommended TaxIdentEnum |
The phylogenetic marker(s) used to assign an organism name to the SAG or MAG |
| MIXS:0000059 | annot | 0..1 recommended String |
Tool used for annotation, or for cases where annotation was provided by a com... |
| MIXS:0001322 | pos_cont_type | 0..1 recommended String |
The substance, mixture, product, or apparatus used to verify that a process w... |
| MIXS:0000020 | subspecf_gen_lin | 0..1 recommended String |
Information about the genetic distinctness of the sequenced organism below th... |
| MIXS:0000061 | feat_pred | 0..1 String |
Method used to predict UViGs features such as ORFs, integration site, etc |
| MIXS:0000013 | env_local_scale | 1 String |
Report the entity or entities which are in the sample or specimen s local vic... |
| MIXS:0000070 | compl_software | 0..1 String |
Tools used for completion estimate, i |
| MIXS:0000016 | samp_mat_process | 0..1 String |
A brief description of any processing applied to the sample during or after r... |
| MIXS:0000063 | sim_search_meth | 0..1 String |
Tool used to compare ORFs with database, along with version and cutoffs used |
| MIXS:0000031 | host_disease_stat | 0..1 recommended String |
List of diseases with which the host has been diagnosed; can include multiple... |
| MIXS:0000018 | depth | 0..1 recommended String |
The vertical distance below local surface |
| MIXS:0001225 | samp_collect_method | 0..1 String |
The method employed for collecting the sample |
| MIXS:0000029 | specific_host | 0..1 recommended String |
Report the host's taxonomic name and/or NCBI taxonomy ID |
| MIXS:0000014 | env_medium | 1 String |
Report the environmental material(s) immediately surrounding the sample or sp... |
| MIXS:0001320 | samp_taxon_id | 1 String |
NCBI taxon id of the sample |
| MIXS:0000010 | geo_loc_name | 1 String |
The geographical origin of the sample as defined by the country or sea name f... |
| MIXS:0000011 | collection_date | 1 Datetime |
The time of sampling, either as an instance (single point in time) or interva... |
| MIXS:0000050 | seq_meth | 1 String |
Sequencing machine used |
| MIXS:0000009 | lat_lon | 1 String |
The geographical origin of the sample as defined by latitude and longitude |
| MIXS:0000093 | elev | 0..1 recommended String |
Elevation of the sampling site is its height above a fixed reference point, m... |
| MIXS:0000012 | env_broad_scale | 1 String |
Report the major environmental system the sample or specimen came from |
| MIXS:0000064 | tax_class | 0..1 String |
Method used for taxonomic classification, along with reference database used,... |
| MIXS:0000008 | experimental_factor | * String |
Variable aspects of an experiment design that can be used to describe an expe... |
| MIXS:0000091 | associated_resource | * recommended String |
A related resource that is referenced, cited, or otherwise associated to the ... |
| MIXS:0000090 | sop | * recommended String |
Standard operating procedures used in assembly and/or annotation of genomes, ... |
| MIXS:0000988 | hcr | 1 HcrEnum |
Main Hydrocarbon Resource type |
| MIXS:0000989 | hc_produced | 1 HcProducedEnum |
Main hydrocarbon type produced from resource (i |
| MIXS:0000290 | basin | 1 String |
Name of the basin (e |
| MIXS:0000291 | field | 0..1 recommended String |
Name of the hydrocarbon field (e |
| MIXS:0000303 | reservoir | 0..1 recommended String |
Name of the reservoir (e |
| MIXS:0000393 | hcr_temp | 0..1 recommended String |
Original temperature of the hydrocarbon resource |
| MIXS:0000394 | tvdss_of_hcr_temp | 0..1 String |
True vertical depth subsea (TVDSS) of the hydrocarbon resource where the orig... |
| MIXS:0000395 | hcr_pressure | 0..1 String |
Original pressure of the hydrocarbon resource |
| MIXS:0000397 | tvdss_of_hcr_press | 0..1 String |
True vertical depth subsea (TVDSS) of the hydrocarbon resource where the orig... |
| MIXS:0000990 | lithology | 0..1 recommended LithologyEnum |
Hydrocarbon resource main lithology (Additional information: http://petrowiki |
| MIXS:0000992 | depos_env | 0..1 recommended DeposEnvEnum |
Main depositional environment (https://en |
| MIXS:0000993 | hcr_geol_age | 0..1 recommended GeolAgeEnum |
Geological age of hydrocarbon resource (Additional info: https://en |
| MIXS:0000406 | hcr_fw_salinity | 0..1 recommended String |
Original formation water salinity (prior to secondary recovery e |
| MIXS:0000407 | sulfate_fw | 0..1 recommended String |
Original sulfate concentration in the hydrocarbon resource |
| MIXS:0000408 | vfa_fw | 0..1 recommended String |
Original volatile fatty acid concentration in the hydrocarbon resource |
| MIXS:0001008 | prod_start_date | 0..1 recommended Datetime |
Date of field's first production |
| MIXS:0000452 | prod_rate | 0..1 recommended String |
Oil and/or gas production rates per well (e |
| MIXS:0000453 | water_prod_rate | 0..1 recommended String |
Water production rates per well (e |
| MIXS:0000454 | water_cut | 1 String |
Current amount of water (%) in a produced fluid stream; or the average of the... |
| MIXS:0000455 | iwf | 1 Float |
Proportion of the produced fluids derived from injected water at the time of ... |
| MIXS:0001009 | add_recov_method | 1 String |
Additional (i |
| MIXS:0001010 | iw_bt_date_well | 0..1 Datetime |
Injection water breakthrough date per well following a secondary and/or terti... |
| MIXS:0001011 | biocide | 0..1 recommended String |
List of biocides (commercial name of product and supplier) and date of admini... |
| MIXS:0000456 | biocide_admin_method | 0..1 recommended String |
Method of biocide administration (dose, frequency, duration, time elapsed bet... |
| MIXS:0001012 | chem_treatment | 0..1 String |
List of chemical compounds administered upstream the sampling location where ... |
| MIXS:0000457 | chem_treat_method | 0..1 String |
Method of chemical administration(dose, frequency, duration, time elapsed bet... |
| MIXS:0000136 | samp_loc_corr_rate | 0..1 recommended String |
Metal corrosion rate is the speed of metal deterioration due to environmental... |
| MIXS:0000296 | samp_well_name | 0..1 recommended String |
Name of the well (e |
| MIXS:0000297 | win | 0..1 recommended String |
A unique identifier of a well or wellbore |
| MIXS:0000998 | samp_type | 1 String |
The type of material from which the sample was obtained |
| MIXS:0000999 | samp_subtype | 0..1 recommended SampSubtypeEnum |
Name of sample sub-type |
| MIXS:0001015 | samp_collect_point | 1 SampCollectPointEnum |
Sampling point on the asset were sample was collected (e |
| MIXS:0000412 | pressure | 0..1 String |
Pressure to which the sample is subject to, in atmospheres |
| MIXS:0000753 | oxy_stat_samp | 0..1 OxyStatSampEnum |
Oxygenation status of sample |
| MIXS:0000463 | samp_preserv | 0..1 String |
Preservative added to the sample (e |
| MIXS:0000410 | samp_transport_cond | 0..1 String |
Sample transport duration (in days or hrs) and temperature the sample was exp... |
| MIXS:0000110 | samp_store_temp | 0..1 String |
Temperature at which sample was stored, e |
| MIXS:0000116 | samp_store_dur | 0..1 String |
Duration for which the sample was stored |
| MIXS:0000755 | samp_store_loc | 0..1 String |
Location at which sample was stored, usually name of a specific freezer/room |
| MIXS:0000103 | organism_count | * recommended String |
Total cell count of any organism (or group of organisms) per gram, volume or ... |
| MIXS:0000099 | org_count_qpcr_info | 0..1 String |
If qpcr was used for the cell count, the target gene name, the primer sequenc... |
| MIXS:0001001 | ph | 0..1 recommended Float |
pH measurement of the sample, or liquid portion of sample, or aqueous phase o... |
| MIXS:0000183 | salinity | 0..1 String |
The total concentration of all dissolved salts in a liquid or solid sample |
| MIXS:0000421 | alkalinity | 0..1 String |
Alkalinity, the ability of a solution to neutralize acids to the equivalence ... |
| MIXS:0000298 | alkalinity_method | 0..1 String |
Method used for alkalinity measurement |
| MIXS:0000423 | sulfate | 1 String |
Concentration of sulfate in the sample |
| MIXS:0000424 | sulfide | 1 String |
Concentration of sulfide in the sample |
| MIXS:0000419 | tot_sulfur | 0..1 recommended String |
Concentration of total sulfur in the sample |
| MIXS:0000425 | nitrate | 1 String |
Concentration of nitrate in the sample |
| MIXS:0000426 | nitrite | 0..1 recommended String |
Concentration of nitrite in the sample |
| MIXS:0000427 | ammonium | 0..1 recommended String |
Concentration of ammonium in the sample |
| MIXS:0000102 | tot_nitro | 0..1 String |
Total nitrogen concentration of water samples, calculated by: total nitrogen ... |
| MIXS:0000139 | diss_iron | 0..1 recommended String |
Concentration of dissolved iron in the sample |
| MIXS:0000428 | sodium | 0..1 String |
Sodium concentration in the sample |
| MIXS:0000429 | chloride | 0..1 String |
Concentration of chloride in the sample |
| MIXS:0000430 | potassium | 0..1 String |
Concentration of potassium in the sample |
| MIXS:0000431 | magnesium | 0..1 String |
Concentration of magnesium in the sample |
| MIXS:0000432 | calcium | 0..1 String |
Concentration of calcium in the sample |
| MIXS:0000105 | tot_iron | 0..1 recommended String |
Concentration of total iron in the sample |
| MIXS:0000433 | diss_org_carb | 0..1 String |
Concentration of dissolved organic carbon in the sample, liquid portion of th... |
| MIXS:0000434 | diss_inorg_carb | 0..1 String |
Dissolved inorganic carbon concentration in the sample, typically measured af... |
| MIXS:0000106 | diss_inorg_phosp | 0..1 recommended String |
Concentration of dissolved inorganic phosphorus in the sample |
| MIXS:0000117 | tot_phosp | 0..1 String |
Total phosphorus concentration in the sample, calculated by: total phosphorus... |
| MIXS:0000150 | suspend_solids | * String |
Concentration of substances including a wide variety of material, such as sil... |
| MIXS:0000435 | density | 0..1 String |
Density of the sample, which is its mass per unit volume (aka volumetric mass... |
| MIXS:0000436 | diss_carb_dioxide | 0..1 String |
Concentration of dissolved carbon dioxide in the sample or liquid portion of ... |
| MIXS:0000438 | diss_oxygen_fluid | 0..1 String |
Concentration of dissolved oxygen in the oil field produced fluids as it cont... |
| MIXS:0000152 | vfa | 0..1 recommended String |
Concentration of Volatile Fatty Acids in the sample |
| MIXS:0000153 | benzene | 0..1 recommended String |
Concentration of benzene in the sample |
| MIXS:0000154 | toluene | 0..1 recommended String |
Concentration of toluene in the sample |
| MIXS:0000155 | ethylbenzene | 0..1 recommended String |
Concentration of ethylbenzene in the sample |
| MIXS:0000156 | xylene | 0..1 recommended String |
Concentration of xylene in the sample |
| MIXS:0000157 | api | 1 String |
API gravity is a measure of how heavy or light a petroleum liquid is compared... |
| MIXS:0000120 | tan | 0..1 recommended String |
Total Acid Number (TAN) is a measurement of acidity that is determined by th... |
| MIXS:0000126 | viscosity | 0..1 String |
A measure of oil's resistance to gradual deformation by shear stress or t... |
| MIXS:0000127 | pour_point | 0..1 String |
Temperature at which a liquid becomes semi solid and loses its flow character... |
| MIXS:0000131 | saturates_pc | 0..1 recommended String |
Saturate, Aromatic, Resin and Asphaltene (SARA) is an analysis method that d... |
| MIXS:0000133 | aromatics_pc | 0..1 recommended String |
Saturate, Aromatic, Resin and Asphaltene (SARA) is an analysis method that d... |
| MIXS:0000134 | resins_pc | 0..1 recommended String |
Saturate, Aromatic, Resin and Asphaltene (SARA) is an analysis method that d... |
| MIXS:0000135 | asphaltenes_pc | 0..1 recommended String |
Saturate, Aromatic, Resin and Asphaltene (SARA) is an analysis method that d... |
| MIXS:0000752 | misc_param | * String |
Any other measurement performed or parameter collected, that is not listed he... |
| MIXS:0000300 | additional_info | 0..1 String |
Information that doesn't fit anywhere else |
LinkML Source
Direct
name: MigsViHydrocarbonResourcesFluidsSwabs
description: MIxS Data that comply with the MigsVi checklist and the HydrocarbonResourcesFluidsSwabs
Extension
title: MigsVi combined with HydrocarbonResourcesFluidsSwabs
in_subset:
- combination_classes
from_schema: https://w3id.org/mixs
is_a: HydrocarbonResourcesFluidsSwabs
mixins:
- MigsVi
class_uri: MIXS:0010005_0016016
Induced
name: MigsViHydrocarbonResourcesFluidsSwabs
description: MIxS Data that comply with the MigsVi checklist and the HydrocarbonResourcesFluidsSwabs
Extension
title: MigsVi combined with HydrocarbonResourcesFluidsSwabs
in_subset:
- combination_classes
from_schema: https://w3id.org/mixs
is_a: HydrocarbonResourcesFluidsSwabs
mixins:
- MigsVi
attributes:
samp_name:
name: samp_name
annotations:
Preferred_unit:
tag: Preferred_unit
value: ''
description: A local identifier or name that for the material sample used for
extracting nucleic acids, and subsequent sequencing. It can refer either to
the original material collected or to any derived sub-samples. It can have any
format, but we suggest that you make it concise, unique and consistent within
your lab, and as informative as possible. INSDC requires every sample name from
a single Submitter to be unique. Use of a globally unique identifier for the
field source_mat_id is recommended in addition to sample_name
title: sample name
examples:
- value: ISDsoil1
in_subset:
- investigation
from_schema: https://w3id.org/mixs
keywords:
- sample
slot_uri: MIXS:0001107
alias: samp_name
owner: MigsViHydrocarbonResourcesFluidsSwabs
domain_of:
- MigsBa
- MigsEu
- MigsOrg
- MigsPl
- MigsVi
- Mimag
- MimarksC
- MimarksS
- Mims
- Misag
- Miuvig
- Air
- BuiltEnvironment
- FoodAnimalAndAnimalFeed
- FoodFarmEnvironment
- FoodFoodProductionFacility
- FoodHumanFoods
- HostAssociated
- HumanAssociated
- HumanGut
- HumanOral
- HumanSkin
- HumanVaginal
- HydrocarbonResourcesCores
- HydrocarbonResourcesFluidsSwabs
- MicrobialMatBiofilm
- MiscellaneousNaturalOrArtificialEnvironment
- PlantAssociated
- Sediment
- Soil
- SymbiontAssociated
- WastewaterSludge
- Water
range: string
required: true
lib_screen:
name: lib_screen
annotations:
Expected_value:
tag: Expected_value
value: screening strategy name
description: Specific enrichment or screening methods applied before and/or after
creating libraries
title: library screening strategy
examples:
- value: enriched, screened, normalized
in_subset:
- sequencing
from_schema: https://w3id.org/mixs
keywords:
- library
slot_uri: MIXS:0000043
alias: lib_screen
owner: MigsViHydrocarbonResourcesFluidsSwabs
domain_of:
- MigsBa
- MigsEu
- MigsOrg
- MigsPl
- MigsVi
- Mimag
- MimarksS
- Mims
- Misag
- Miuvig
- Agriculture
range: string
ref_db:
name: ref_db
annotations:
Expected_value:
tag: Expected_value
value: names, versions, and references of databases
description: List of database(s) used for ORF annotation, along with version number
and reference to website or publication
title: reference database(s)
examples:
- value: pVOGs;5;http://dmk-brain.ecn.uiowa.edu/pVOGs/ Grazziotin et al. 2017
doi:10.1093/nar/gkw975
in_subset:
- sequencing
from_schema: https://w3id.org/mixs
keywords:
- database
string_serialization: '{database};{version};{reference}'
slot_uri: MIXS:0000062
alias: ref_db
owner: MigsViHydrocarbonResourcesFluidsSwabs
domain_of:
- MigsBa
- MigsEu
- MigsOrg
- MigsPl
- MigsVi
- Mimag
- Mims
- Misag
- Miuvig
range: string
nucl_acid_amp:
name: nucl_acid_amp
description: A link to a literature reference, electronic resource or a standard
operating procedure (SOP), that describes the enzymatic amplification (PCR,
TMA, NASBA) of specific nucleic acids
title: nucleic acid amplification
examples:
- value: https://phylogenomics.me/protocols/16s-pcr-protocol/
in_subset:
- sequencing
from_schema: https://w3id.org/mixs
slot_uri: MIXS:0000038
alias: nucl_acid_amp
owner: MigsViHydrocarbonResourcesFluidsSwabs
domain_of:
- MigsBa
- MigsEu
- MigsOrg
- MigsPl
- MigsVi
- Mimag
- MimarksC
- MimarksS
- Mims
- Misag
- Miuvig
- Agriculture
range: string
recommended: true
structured_pattern:
syntax: ^{PMID}|{DOI}|{URL}$
interpolated: true
partial_match: true
lib_size:
name: lib_size
description: Total number of clones in the library prepared for the project
title: library size
examples:
- value: '50'
in_subset:
- sequencing
from_schema: https://w3id.org/mixs
keywords:
- library
- size
slot_uri: MIXS:0000039
alias: lib_size
owner: MigsViHydrocarbonResourcesFluidsSwabs
domain_of:
- MigsBa
- MigsEu
- MigsOrg
- MigsPl
- MigsVi
- Mimag
- MimarksS
- Mims
- Misag
- Miuvig
- Agriculture
range: integer
assembly_name:
name: assembly_name
annotations:
Expected_value:
tag: Expected_value
value: name and version of assembly
description: Name/version of the assembly provided by the submitter that is used
in the genome browsers and in the community
title: assembly name
examples:
- value: HuRef, JCVI_ISG_i3_1.0
in_subset:
- sequencing
from_schema: https://w3id.org/mixs
string_serialization: '{text} {text}'
slot_uri: MIXS:0000057
alias: assembly_name
owner: MigsViHydrocarbonResourcesFluidsSwabs
domain_of:
- MigsBa
- MigsEu
- MigsOrg
- MigsPl
- MigsVi
- Mimag
- Mims
- Misag
- Miuvig
- Agriculture
range: string
recommended: true
temp:
name: temp
annotations:
Preferred_unit:
tag: Preferred_unit
value: degree Celsius
description: Temperature of the sample at the time of sampling
title: temperature
examples:
- value: 25 degree Celsius
in_subset:
- environment
from_schema: https://w3id.org/mixs
keywords:
- temperature
slot_uri: MIXS:0000113
alias: temp
owner: MigsViHydrocarbonResourcesFluidsSwabs
domain_of:
- MigsBa
- MigsEu
- MigsOrg
- MigsPl
- MigsVi
- Mimag
- MimarksC
- MimarksS
- Mims
- Misag
- Miuvig
- Agriculture
- Air
- FoodAnimalAndAnimalFeed
- FoodFarmEnvironment
- FoodHumanFoods
- HostAssociated
- HumanAssociated
- HumanGut
- HumanOral
- HumanSkin
- HumanVaginal
- HydrocarbonResourcesCores
- HydrocarbonResourcesFluidsSwabs
- MicrobialMatBiofilm
- MiscellaneousNaturalOrArtificialEnvironment
- PlantAssociated
- Sediment
- Soil
- SymbiontAssociated
- WastewaterSludge
- Water
range: string
required: true
recommended: true
structured_pattern:
syntax: ^{scientific_float}( *- *{scientific_float})? *{text}$
interpolated: true
partial_match: true
compl_score:
name: compl_score
annotations:
Expected_value:
tag: Expected_value
value: quality;percent completeness
description: 'Completeness score is typically based on either the fraction of
markers found as compared to a database or the percent of a genome found as
compared to a closely related reference genome. High Quality Draft: >90%, Medium
Quality Draft: >50%, and Low Quality Draft: < 50% should have the indicated
completeness scores'
title: completeness score
examples:
- value: med;60%
in_subset:
- sequencing
from_schema: https://w3id.org/mixs
keywords:
- score
string_serialization: '[high|med|low];{percentage}'
slot_uri: MIXS:0000069
alias: compl_score
owner: MigsViHydrocarbonResourcesFluidsSwabs
domain_of:
- MigsBa
- MigsEu
- MigsOrg
- MigsPl
- MigsVi
- Mimag
- Misag
- Miuvig
range: string
nucl_acid_ext:
name: nucl_acid_ext
description: A link to a literature reference, electronic resource or a standard
operating procedure (SOP), that describes the material separation to recover
the nucleic acid fraction from a sample
title: nucleic acid extraction
examples:
- value: https://mobio.com/media/wysiwyg/pdfs/protocols/12888.pdf
in_subset:
- sequencing
from_schema: https://w3id.org/mixs
slot_uri: MIXS:0000037
alias: nucl_acid_ext
owner: MigsViHydrocarbonResourcesFluidsSwabs
domain_of:
- MigsBa
- MigsEu
- MigsOrg
- MigsPl
- MigsVi
- Mimag
- MimarksC
- MimarksS
- Mims
- Misag
- Miuvig
- Agriculture
- FoodAnimalAndAnimalFeed
- FoodFarmEnvironment
- FoodFoodProductionFacility
- FoodHumanFoods
range: string
recommended: true
structured_pattern:
syntax: ^{PMID}|{DOI}|{URL}$
interpolated: true
partial_match: true
samp_size:
name: samp_size
description: The total amount or size (volume (ml), mass (g) or area (m2) ) of
sample collected
title: amount or size of sample collected
examples:
- value: 5 liter
in_subset:
- nucleic acid sequence source
from_schema: https://w3id.org/mixs
keywords:
- sample
- size
slot_uri: MIXS:0000001
alias: samp_size
owner: MigsViHydrocarbonResourcesFluidsSwabs
domain_of:
- MigsBa
- MigsEu
- MigsOrg
- MigsPl
- MigsVi
- Mimag
- MimarksC
- MimarksS
- Mims
- Misag
- Miuvig
- Agriculture
- FoodAnimalAndAnimalFeed
- FoodFarmEnvironment
- FoodFoodProductionFacility
- FoodHumanFoods
range: string
structured_pattern:
syntax: ^{scientific_float}( *- *{scientific_float})? *{text}$
interpolated: true
partial_match: true
isol_growth_condt:
name: isol_growth_condt
description: Publication reference in the form of pubmed ID (pmid), digital object
identifier (doi) or url for isolation and growth condition specifications of
the organism/material
title: isolation and growth condition
examples:
- value: doi:10.1016/j.syapm.2018.01.009
in_subset:
- nucleic acid sequence source
from_schema: https://w3id.org/mixs
keywords:
- condition
- growth
- isolation
slot_uri: MIXS:0000003
alias: isol_growth_condt
owner: MigsViHydrocarbonResourcesFluidsSwabs
domain_of:
- MigsBa
- MigsEu
- MigsOrg
- MigsPl
- MigsVi
- MimarksC
- Agriculture
range: string
required: true
structured_pattern:
syntax: ^{PMID}|{DOI}|{URL}$
interpolated: true
partial_match: true
alt:
name: alt
annotations:
Preferred_unit:
tag: Preferred_unit
value: meter
description: Heights of objects such as airplanes, space shuttles, rockets, atmospheric
balloons and heights of places such as atmospheric layers and clouds. It is
used to measure the height of an object which is above the earth's surface.
In this context, the altitude measurement is the vertical distance between the
earth's surface above sea level and the sampled position in the air
title: altitude
examples:
- value: 100 meter
in_subset:
- environment
from_schema: https://w3id.org/mixs
slot_uri: MIXS:0000094
alias: alt
owner: MigsViHydrocarbonResourcesFluidsSwabs
domain_of:
- MigsBa
- MigsEu
- MigsOrg
- MigsPl
- MigsVi
- Mimag
- MimarksC
- MimarksS
- Mims
- Misag
- Miuvig
- Air
- HostAssociated
- MiscellaneousNaturalOrArtificialEnvironment
- SymbiontAssociated
range: string
recommended: true
structured_pattern:
syntax: ^{scientific_float}( *- *{scientific_float})? *{text}$
interpolated: true
partial_match: true
source_mat_id:
name: source_mat_id
annotations:
Expected_value:
tag: Expected_value
value: 'for cultures of microorganisms: identifiers for two culture collections;
for other material a unique arbitrary identifer'
description: A unique identifier assigned to a material sample (as defined by
http://rs.tdwg.org/dwc/terms/materialSampleID, and as opposed to a particular
digital record of a material sample) used for extracting nucleic acids, and
subsequent sequencing. The identifier can refer either to the original material
collected or to any derived sub-samples. The INSDC qualifiers /specimen_voucher,
/bio_material, or /culture_collection may or may not share the same value as
the source_mat_id field. For instance, the /specimen_voucher qualifier and source_mat_id
may both contain 'UAM:Herps:14' , referring to both the specimen voucher and
sampled tissue with the same identifier. However, the /culture_collection qualifier
may refer to a value from an initial culture (e.g. ATCC:11775) while source_mat_id
would refer to an identifier from some derived culture from which the nucleic
acids were extracted (e.g. xatc123 or ark:/2154/R2)
title: source material identifiers
examples:
- value: MPI012345
in_subset:
- nucleic acid sequence source
from_schema: https://w3id.org/mixs
keywords:
- identifier
- material
- source
slot_uri: MIXS:0000026
alias: source_mat_id
owner: MigsViHydrocarbonResourcesFluidsSwabs
domain_of:
- MigsBa
- MigsEu
- MigsOrg
- MigsPl
- MigsVi
- Mimag
- MimarksC
- MimarksS
- Mims
- Misag
- Miuvig
- Agriculture
- SymbiontAssociated
range: string
recommended: true
multivalued: true
estimated_size:
name: estimated_size
annotations:
Expected_value:
tag: Expected_value
value: number of base pairs
description: The estimated size of the genome prior to sequencing. Of particular
importance in the sequencing of (eukaryotic) genome which could remain in draft
form for a long or unspecified period
title: estimated size
examples:
- value: 300000 bp
in_subset:
- nucleic acid sequence source
from_schema: https://w3id.org/mixs
keywords:
- size
string_serialization: '{integer} bp'
slot_uri: MIXS:0000024
alias: estimated_size
owner: MigsViHydrocarbonResourcesFluidsSwabs
domain_of:
- MigsBa
- MigsEu
- MigsOrg
- MigsPl
- MigsVi
- Miuvig
range: string
samp_vol_we_dna_ext:
name: samp_vol_we_dna_ext
annotations:
Preferred_unit:
tag: Preferred_unit
value: milliliter, gram, milligram, square centimeter
description: 'Volume (ml) or mass (g) of total collected sample processed for
DNA extraction. Note: total sample collected should be entered under the term
Sample Size (MIXS:0000001)'
title: sample volume or weight for DNA extraction
examples:
- value: 1500 milliliter
in_subset:
- nucleic acid sequence source
from_schema: https://w3id.org/mixs
keywords:
- dna
- sample
- volume
- weight
slot_uri: MIXS:0000111
alias: samp_vol_we_dna_ext
owner: MigsViHydrocarbonResourcesFluidsSwabs
domain_of:
- MigsBa
- MigsEu
- MigsOrg
- MigsPl
- MigsVi
- Mimag
- MimarksC
- MimarksS
- Mims
- Misag
- Miuvig
- Agriculture
- Air
- FoodAnimalAndAnimalFeed
- FoodFarmEnvironment
- FoodFoodProductionFacility
- FoodHumanFoods
- HostAssociated
- HumanAssociated
- HumanGut
- HumanOral
- HumanSkin
- HumanVaginal
- HydrocarbonResourcesCores
- HydrocarbonResourcesFluidsSwabs
- MicrobialMatBiofilm
- MiscellaneousNaturalOrArtificialEnvironment
- PlantAssociated
- Sediment
- Soil
- SymbiontAssociated
- WastewaterSludge
- Water
range: string
recommended: true
structured_pattern:
syntax: ^{scientific_float}( *- *{scientific_float})? *{text}$
interpolated: true
partial_match: true
pathogenicity:
name: pathogenicity
annotations:
Expected_value:
tag: Expected_value
value: names of organisms that the entity is pathogenic to
description: To what is the entity pathogenic
title: known pathogenicity
examples:
- value: human, animal, plant, fungi, bacteria
in_subset:
- nucleic acid sequence source
from_schema: https://w3id.org/mixs
slot_uri: MIXS:0000027
alias: pathogenicity
owner: MigsViHydrocarbonResourcesFluidsSwabs
domain_of:
- MigsBa
- MigsEu
- MigsVi
- Miuvig
- Agriculture
range: string
recommended: true
lib_reads_seqd:
name: lib_reads_seqd
description: Total number of clones sequenced from the library
title: library reads sequenced
examples:
- value: '20'
in_subset:
- sequencing
from_schema: https://w3id.org/mixs
keywords:
- library
slot_uri: MIXS:0000040
alias: lib_reads_seqd
owner: MigsViHydrocarbonResourcesFluidsSwabs
domain_of:
- MigsBa
- MigsEu
- MigsOrg
- MigsPl
- MigsVi
- Mimag
- MimarksS
- Mims
- Misag
- Miuvig
- Agriculture
range: integer
encoded_traits:
name: encoded_traits
annotations:
Expected_value:
tag: Expected_value
value: 'for plasmid: antibiotic resistance; for phage: converting genes'
description: Should include key traits like antibiotic resistance or xenobiotic
degradation phenotypes for plasmids, converting genes for phage
title: encoded traits
examples:
- value: beta-lactamase class A
in_subset:
- nucleic acid sequence source
from_schema: https://w3id.org/mixs
slot_uri: MIXS:0000034
alias: encoded_traits
owner: MigsViHydrocarbonResourcesFluidsSwabs
domain_of:
- MigsBa
- MigsPl
- MigsVi
range: string
recommended: true
propagation:
name: propagation
annotations:
Expected_value:
tag: Expected_value
value: 'for virus: lytic, lysogenic, temperate, obligately lytic; for plasmid:
incompatibility group; for eukaryote: asexual, sexual; other more specific
values (e.g., incompatibility group) are allowed'
description: 'The type of reproduction from the parent stock. Values for this
field is specific to different taxa. For phage or virus: lytic/lysogenic/temperate/obligately
lytic. For plasmids: incompatibility group. For eukaryotes: sexual/asexual'
title: propagation
examples:
- value: lytic
in_subset:
- nucleic acid sequence source
from_schema: https://w3id.org/mixs
slot_uri: MIXS:0000033
alias: propagation
owner: MigsViHydrocarbonResourcesFluidsSwabs
domain_of:
- MigsEu
- MigsPl
- MigsVi
range: string
required: true
samp_collect_device:
name: samp_collect_device
annotations:
Expected_value:
tag: Expected_value
value: device name
description: The device used to collect an environmental sample. This field accepts
terms listed under environmental sampling device (http://purl.obolibrary.org/obo/ENVO).
This field also accepts terms listed under specimen collection device (http://purl.obolibrary.org/obo/GENEPIO_0002094)
title: sample collection device
examples:
- value: swab, biopsy, niskin bottle, push core, drag swab [GENEPIO:0002713]
in_subset:
- nucleic acid sequence source
from_schema: https://w3id.org/mixs
keywords:
- device
- sample
string_serialization: '{termLabel} [{termID}]|{text}'
slot_uri: MIXS:0000002
alias: samp_collect_device
owner: MigsViHydrocarbonResourcesFluidsSwabs
domain_of:
- MigsBa
- MigsEu
- MigsOrg
- MigsPl
- MigsVi
- Mimag
- MimarksC
- MimarksS
- Mims
- Misag
- Miuvig
- Agriculture
- FoodAnimalAndAnimalFeed
- FoodFarmEnvironment
- FoodFoodProductionFacility
- FoodHumanFoods
range: string
number_contig:
name: number_contig
description: Total number of contigs in the cleaned/submitted assembly that makes
up a given genome, SAG, MAG, or UViG
title: number of contigs
examples:
- value: '40'
in_subset:
- sequencing
from_schema: https://w3id.org/mixs
keywords:
- number
slot_uri: MIXS:0000060
alias: number_contig
owner: MigsViHydrocarbonResourcesFluidsSwabs
domain_of:
- MigsBa
- MigsEu
- MigsOrg
- MigsPl
- MigsVi
- Mimag
- Mims
- Misag
- Miuvig
range: integer
biotic_relationship:
name: biotic_relationship
description: Description of relationship(s) between the subject organism and other
organism(s) it is associated with. E.g., parasite on species X; mutualist with
species Y. The target organism is the subject of the relationship, and the other
organism(s) is the object
title: observed biotic relationship
examples:
- value: free living
in_subset:
- nucleic acid sequence source
from_schema: https://w3id.org/mixs
keywords:
- observed
- relationship
slot_uri: MIXS:0000028
alias: biotic_relationship
owner: MigsViHydrocarbonResourcesFluidsSwabs
domain_of:
- MigsBa
- MigsEu
- MigsVi
- MimarksC
- Miuvig
- Agriculture
range: BioticRelationshipEnum
num_replicons:
name: num_replicons
annotations:
Expected_value:
tag: Expected_value
value: 'for eukaryotes and bacteria: chromosomes (haploid count); for viruses:
segments'
description: Reports the number of replicons in a nuclear genome of eukaryotes,
in the genome of a bacterium or archaea or the number of segments in a segmented
virus. Always applied to the haploid chromosome count of a eukaryote
title: number of replicons
examples:
- value: '2'
in_subset:
- nucleic acid sequence source
from_schema: https://w3id.org/mixs
keywords:
- number
string_serialization: '{integer}'
slot_uri: MIXS:0000022
alias: num_replicons
owner: MigsViHydrocarbonResourcesFluidsSwabs
domain_of:
- MigsBa
- MigsEu
- MigsVi
range: integer
recommended: true
lib_layout:
name: lib_layout
description: Specify whether to expect single, paired, or other configuration
of reads
title: library layout
examples:
- value: paired
in_subset:
- sequencing
from_schema: https://w3id.org/mixs
keywords:
- library
slot_uri: MIXS:0000041
alias: lib_layout
owner: MigsViHydrocarbonResourcesFluidsSwabs
domain_of:
- MigsBa
- MigsEu
- MigsOrg
- MigsPl
- MigsVi
- Mimag
- MimarksS
- Mims
- Misag
- Miuvig
- Agriculture
range: LibLayoutEnum
assembly_qual:
name: assembly_qual
description: 'The assembly quality category is based on sets of criteria outlined
for each assembly quality category. For MISAG/MIMAG; Finished: Single, validated,
contiguous sequence per replicon without gaps or ambiguities with a consensus
error rate equivalent to Q50 or better. High Quality Draft:Multiple fragments
where gaps span repetitive regions. Presence of the large subunit (LSU) RNA,
small subunit (SSU) and the presence of 5.8S rRNA or 5S rRNA depending on whether
it is a eukaryotic or prokaryotic genome, respectively. Medium Quality Draft:Many
fragments with little to no review of assembly other than reporting of standard
assembly statistics. Low Quality Draft:Many fragments with little to no review
of assembly other than reporting of standard assembly statistics. Assembly statistics
include, but are not limited to total assembly size, number of contigs, contig
N50/L50, and maximum contig length. For MIUVIG; Finished: Single, validated,
contiguous sequence per replicon without gaps or ambiguities, with extensive
manual review and editing to annotate putative gene functions and transcriptional
units. High-quality draft genome: One or multiple fragments, totaling 90%
of the expected genome or replicon sequence or predicted complete. Genome fragment(s):
One or multiple fragments, totalling < 90% of the expected genome or replicon
sequence, or for which no genome size could be estimated'
title: assembly quality
examples:
- value: High-quality draft genome
in_subset:
- sequencing
from_schema: https://w3id.org/mixs
keywords:
- quality
slot_uri: MIXS:0000056
alias: assembly_qual
owner: MigsViHydrocarbonResourcesFluidsSwabs
domain_of:
- MigsBa
- MigsEu
- MigsOrg
- MigsPl
- MigsVi
- Mimag
- Mims
- Misag
- Miuvig
- Agriculture
range: AssemblyQualEnum
ref_biomaterial:
name: ref_biomaterial
description: Primary publication if isolated before genome publication; otherwise,
primary genome report
title: reference for biomaterial
examples:
- value: doi:10.1016/j.syapm.2018.01.009
in_subset:
- nucleic acid sequence source
from_schema: https://w3id.org/mixs
slot_uri: MIXS:0000025
alias: ref_biomaterial
owner: MigsViHydrocarbonResourcesFluidsSwabs
domain_of:
- MigsBa
- MigsEu
- MigsOrg
- MigsPl
- MigsVi
- Mimag
- Mims
- Misag
- Miuvig
range: string
structured_pattern:
syntax: ^{PMID}|{DOI}|{URL}$
interpolated: true
partial_match: true
project_name:
name: project_name
description: Name of the project within which the sequencing was organized
title: project name
examples:
- value: Forest soil metagenome
in_subset:
- investigation
from_schema: https://w3id.org/mixs
keywords:
- project
slot_uri: MIXS:0000092
alias: project_name
owner: MigsViHydrocarbonResourcesFluidsSwabs
domain_of:
- MigsBa
- MigsEu
- MigsOrg
- MigsPl
- MigsVi
- Mimag
- MimarksC
- MimarksS
- Mims
- Misag
- Miuvig
- Air
- BuiltEnvironment
- FoodAnimalAndAnimalFeed
- FoodFarmEnvironment
- FoodFoodProductionFacility
- FoodHumanFoods
- HostAssociated
- HumanAssociated
- HumanGut
- HumanOral
- HumanSkin
- HumanVaginal
- HydrocarbonResourcesCores
- HydrocarbonResourcesFluidsSwabs
- MicrobialMatBiofilm
- MiscellaneousNaturalOrArtificialEnvironment
- PlantAssociated
- Sediment
- Soil
- SymbiontAssociated
- WastewaterSludge
- Water
range: string
required: true
lib_vector:
name: lib_vector
annotations:
Expected_value:
tag: Expected_value
value: vector
description: Cloning vector type(s) used in construction of libraries
title: library vector
examples:
- value: Bacteriophage P1
in_subset:
- sequencing
from_schema: https://w3id.org/mixs
keywords:
- library
slot_uri: MIXS:0000042
alias: lib_vector
owner: MigsViHydrocarbonResourcesFluidsSwabs
domain_of:
- MigsBa
- MigsEu
- MigsOrg
- MigsPl
- MigsVi
- Mimag
- MimarksS
- Mims
- Misag
- Miuvig
- Agriculture
range: string
host_spec_range:
name: host_spec_range
annotations:
Expected_value:
tag: Expected_value
value: NCBI taxid
description: The range and diversity of host species that an organism is capable
of infecting, defined by NCBI taxonomy identifier
title: host specificity or range
examples:
- value: '9606'
in_subset:
- nucleic acid sequence source
from_schema: https://w3id.org/mixs
keywords:
- host
- host.
- range
string_serialization: '{integer}'
slot_uri: MIXS:0000030
alias: host_spec_range
owner: MigsViHydrocarbonResourcesFluidsSwabs
domain_of:
- MigsBa
- MigsEu
- MigsPl
- MigsVi
- Miuvig
- Agriculture
range: string
recommended: true
multivalued: true
neg_cont_type:
name: neg_cont_type
annotations:
Expected_value:
tag: Expected_value
value: enumeration or text
description: The substance or equipment used as a negative control in an investigation
title: negative control type
in_subset:
- investigation
from_schema: https://w3id.org/mixs
keywords:
- type
slot_uri: MIXS:0001321
alias: neg_cont_type
owner: MigsViHydrocarbonResourcesFluidsSwabs
domain_of:
- MigsBa
- MigsEu
- MigsOrg
- MigsPl
- MigsVi
- Mimag
- MimarksC
- MimarksS
- Mims
- Misag
- Miuvig
range: NegContTypeEnum
recommended: true
virus_enrich_appr:
name: virus_enrich_appr
description: List of approaches used to enrich the sample for viruses, if any
title: virus enrichment approach
examples:
- value: filtration
description: was filtration + FeCl Precipitation + ultracentrifugation + DNAse
- value: FeCl Precipitation
description: was filtration + FeCl Precipitation + ultracentrifugation + DNAse
- value: ultracentrifugation
description: was filtration + FeCl Precipitation + ultracentrifugation + DNAse
- value: DNAse
description: was filtration + FeCl Precipitation + ultracentrifugation + DNAse
in_subset:
- nucleic acid sequence source
from_schema: https://w3id.org/mixs
keywords:
- enrichment
slot_uri: MIXS:0000036
alias: virus_enrich_appr
owner: MigsViHydrocarbonResourcesFluidsSwabs
domain_of:
- MigsVi
- Miuvig
range: VirusEnrichApprEnum
recommended: true
adapters:
name: adapters
description: Adapters provide priming sequences for both amplification and sequencing
of the sample-library fragments. Both adapters should be reported; in uppercase
letters
title: adapters
examples:
- value: AATGATACGGCGACCACCGAGATCTACACGCT;CAAGCAGAAGACGGCATACGAGAT
in_subset:
- sequencing
from_schema: https://w3id.org/mixs
slot_uri: MIXS:0000048
alias: adapters
owner: MigsViHydrocarbonResourcesFluidsSwabs
domain_of:
- MigsBa
- MigsEu
- MigsOrg
- MigsPl
- MigsVi
- Mimag
- MimarksS
- Mims
- Misag
- Miuvig
- Agriculture
range: string
recommended: true
structured_pattern:
syntax: ^{dna_bases};{dna_bases}$
interpolated: true
partial_match: true
assembly_software:
name: assembly_software
description: Tool(s) used for assembly, including version number and parameters
title: assembly software
examples:
- value: metaSPAdes;3.11.0;kmer set 21,33,55,77,99,121, default parameters otherwise
in_subset:
- sequencing
from_schema: https://w3id.org/mixs
keywords:
- software
slot_uri: MIXS:0000058
alias: assembly_software
owner: MigsViHydrocarbonResourcesFluidsSwabs
domain_of:
- MigsBa
- MigsEu
- MigsOrg
- MigsPl
- MigsVi
- Mimag
- MimarksS
- Mims
- Misag
- Miuvig
- Agriculture
range: string
required: true
structured_pattern:
syntax: ^{software};{version};{parameters}$
interpolated: true
partial_match: true
tax_ident:
name: tax_ident
description: The phylogenetic marker(s) used to assign an organism name to the
SAG or MAG
title: taxonomic identity marker
examples:
- value: other
description: was other <colon> rpoB gene
in_subset:
- sequencing
from_schema: https://w3id.org/mixs
keywords:
- identifier
- marker
- taxon
slot_uri: MIXS:0000053
alias: tax_ident
owner: MigsViHydrocarbonResourcesFluidsSwabs
domain_of:
- MigsBa
- MigsEu
- MigsOrg
- MigsPl
- MigsVi
- Mimag
- Misag
- Miuvig
range: TaxIdentEnum
recommended: true
annot:
name: annot
annotations:
Expected_value:
tag: Expected_value
value: name of tool or pipeline used, or annotation source description
description: Tool used for annotation, or for cases where annotation was provided
by a community jamboree or model organism database rather than by a specific
submitter
title: annotation
examples:
- value: prokka
in_subset:
- sequencing
from_schema: https://w3id.org/mixs
slot_uri: MIXS:0000059
alias: annot
owner: MigsViHydrocarbonResourcesFluidsSwabs
domain_of:
- MigsBa
- MigsEu
- MigsOrg
- MigsPl
- MigsVi
- Mimag
- Mims
- Misag
- Miuvig
- Agriculture
range: string
recommended: true
pos_cont_type:
name: pos_cont_type
description: The substance, mixture, product, or apparatus used to verify that
a process which is part of an investigation delivers a true positive
title: positive control type
in_subset:
- investigation
from_schema: https://w3id.org/mixs
keywords:
- type
string_serialization: '{term} or {text}'
slot_uri: MIXS:0001322
alias: pos_cont_type
owner: MigsViHydrocarbonResourcesFluidsSwabs
domain_of:
- MigsBa
- MigsEu
- MigsOrg
- MigsPl
- MigsVi
- Mimag
- MimarksC
- MimarksS
- Mims
- Misag
- Miuvig
range: string
recommended: true
subspecf_gen_lin:
name: subspecf_gen_lin
annotations:
Expected_value:
tag: Expected_value
value: Genetic lineage below lowest rank of NCBI taxonomy, which is subspecies,
e.g. serovar, biotype, ecotype, variety, cultivar
description: Information about the genetic distinctness of the sequenced organism
below the subspecies level, e.g., serovar, serotype, biotype, ecotype, or any
relevant genetic typing schemes like Group I plasmid. Subspecies should not
be recorded in this term, but in the NCBI taxonomy. Supply both the lineage
name and the lineage rank separated by a colon, e.g., biovar:abc123
title: subspecific genetic lineage
examples:
- value: serovar:Newport
in_subset:
- nucleic acid sequence source
from_schema: https://w3id.org/mixs
keywords:
- lineage
string_serialization: '{rank name}:{text}'
slot_uri: MIXS:0000020
alias: subspecf_gen_lin
owner: MigsViHydrocarbonResourcesFluidsSwabs
domain_of:
- MigsBa
- MigsEu
- MigsOrg
- MigsPl
- MigsVi
- MimarksC
- FoodFoodProductionFacility
range: string
recommended: true
feat_pred:
name: feat_pred
description: Method used to predict UViGs features such as ORFs, integration site,
etc
title: feature prediction
examples:
- value: Prodigal;2.6.3;default parameters
in_subset:
- sequencing
from_schema: https://w3id.org/mixs
keywords:
- feature
- predict
slot_uri: MIXS:0000061
alias: feat_pred
owner: MigsViHydrocarbonResourcesFluidsSwabs
domain_of:
- MigsBa
- MigsEu
- MigsOrg
- MigsPl
- MigsVi
- Mimag
- Mims
- Misag
- Miuvig
range: string
structured_pattern:
syntax: ^{software};{version};{parameters}$
interpolated: true
partial_match: true
env_local_scale:
name: env_local_scale
annotations:
Expected_value:
tag: Expected_value
value: Environmental entities having causal influences upon the entity at
time of sampling
description: 'Report the entity or entities which are in the sample or specimen
s local vicinity and which you believe have significant causal influences on
your sample or specimen. We recommend using EnvO terms which are of smaller
spatial grain than your entry for env_broad_scale. Terms, such as anatomical
sites, from other OBO Library ontologies which interoperate with EnvO (e.g.
UBERON) are accepted in this field. EnvO documentation about how to use the
field: https://github.com/EnvironmentOntology/envo/wiki/Using-ENVO-with-MIxS'
title: local environmental context
examples:
- value: hillside [ENVO:01000333]
in_subset:
- environment
from_schema: https://w3id.org/mixs
keywords:
- context
- environmental
slot_uri: MIXS:0000013
alias: env_local_scale
owner: MigsViHydrocarbonResourcesFluidsSwabs
domain_of:
- MigsBa
- MigsEu
- MigsOrg
- MigsPl
- MigsVi
- Mimag
- MimarksC
- MimarksS
- Mims
- Misag
- Miuvig
range: string
required: true
structured_pattern:
syntax: ^{termLabel} \[{termID}\]$
interpolated: true
partial_match: true
compl_software:
name: compl_software
annotations:
Expected_value:
tag: Expected_value
value: names and versions of software(s) used
description: Tools used for completion estimate, i.e. checkm, anvi'o, busco
title: completeness software
examples:
- value: checkm
in_subset:
- sequencing
from_schema: https://w3id.org/mixs
keywords:
- software
string_serialization: '{software};{version}'
slot_uri: MIXS:0000070
alias: compl_software
owner: MigsViHydrocarbonResourcesFluidsSwabs
domain_of:
- MigsBa
- MigsEu
- MigsOrg
- MigsPl
- MigsVi
- Mimag
- Misag
- Miuvig
range: string
samp_mat_process:
name: samp_mat_process
description: A brief description of any processing applied to the sample during
or after retrieving the sample from environment, or a link to the relevant protocol(s)
performed
title: sample material processing
examples:
- value: filtering of seawater, storing samples in ethanol
in_subset:
- nucleic acid sequence source
from_schema: https://w3id.org/mixs
keywords:
- material
- process
- sample
slot_uri: MIXS:0000016
alias: samp_mat_process
owner: MigsViHydrocarbonResourcesFluidsSwabs
domain_of:
- MigsBa
- MigsEu
- MigsOrg
- MigsPl
- MigsVi
- Mimag
- MimarksC
- MimarksS
- Mims
- Misag
- Miuvig
- Agriculture
range: string
sim_search_meth:
name: sim_search_meth
description: Tool used to compare ORFs with database, along with version and cutoffs
used
title: similarity search method
examples:
- value: HMMER3;3.1b2;hmmsearch, cutoff of 50 on score
in_subset:
- sequencing
from_schema: https://w3id.org/mixs
keywords:
- method
slot_uri: MIXS:0000063
alias: sim_search_meth
owner: MigsViHydrocarbonResourcesFluidsSwabs
domain_of:
- MigsBa
- MigsEu
- MigsOrg
- MigsPl
- MigsVi
- Mimag
- Mims
- Misag
- Miuvig
range: string
structured_pattern:
syntax: ^{software};{version};{parameters}$
interpolated: true
partial_match: true
host_disease_stat:
name: host_disease_stat
annotations:
Expected_value:
tag: Expected_value
value: disease name or Disease Ontology term
description: List of diseases with which the host has been diagnosed; can include
multiple diagnoses. The value of the field depends on host; for humans the terms
should be chosen from the DO (Human Disease Ontology) at https://www.disease-ontology.org,
non-human host diseases are free text
title: host disease status
examples:
- value: rabies [DOID:11260]
in_subset:
- nucleic acid sequence source
from_schema: https://w3id.org/mixs
keywords:
- disease
- host
- host.
- status
string_serialization: '{termLabel} [{termID}]|{text}'
slot_uri: MIXS:0000031
alias: host_disease_stat
owner: MigsViHydrocarbonResourcesFluidsSwabs
domain_of:
- MigsBa
- MigsEu
- MigsVi
- Miuvig
- Agriculture
- FoodFarmEnvironment
- HostAssociated
- HumanAssociated
- HumanGut
- HumanOral
- HumanSkin
- HumanVaginal
- PlantAssociated
range: string
recommended: true
depth:
name: depth
annotations:
Preferred_unit:
tag: Preferred_unit
value: meter
description: The vertical distance below local surface. For sediment or soil samples
depth is measured from sediment or soil surface, respectively. Depth can be
reported as an interval for subsurface samples
title: depth
examples:
- value: 10 meter
in_subset:
- environment
from_schema: https://w3id.org/mixs
keywords:
- depth
slot_uri: MIXS:0000018
alias: depth
owner: MigsViHydrocarbonResourcesFluidsSwabs
domain_of:
- MigsBa
- MigsEu
- MigsOrg
- MigsPl
- MigsVi
- Mimag
- MimarksC
- MimarksS
- Mims
- Misag
- Miuvig
- Agriculture
- FoodFarmEnvironment
- HostAssociated
- MicrobialMatBiofilm
- MiscellaneousNaturalOrArtificialEnvironment
- PlantAssociated
- Sediment
- Soil
- SymbiontAssociated
- WastewaterSludge
- Water
range: string
recommended: true
structured_pattern:
syntax: ^{scientific_float}( *- *{scientific_float})? *{text}$
interpolated: true
partial_match: true
samp_collect_method:
name: samp_collect_method
description: The method employed for collecting the sample
title: sample collection method
examples:
- value: swabbing
in_subset:
- nucleic acid sequence source
from_schema: https://w3id.org/mixs
keywords:
- method
- sample
slot_uri: MIXS:0001225
alias: samp_collect_method
owner: MigsViHydrocarbonResourcesFluidsSwabs
domain_of:
- MigsBa
- MigsEu
- MigsOrg
- MigsPl
- MigsVi
- Mimag
- MimarksC
- MimarksS
- Mims
- Misag
- Miuvig
- Agriculture
- FoodAnimalAndAnimalFeed
- FoodFoodProductionFacility
- FoodHumanFoods
range: string
structured_pattern:
syntax: ^{PMID}|{DOI}|{URL}|{text}$
interpolated: true
partial_match: true
specific_host:
name: specific_host
annotations:
Expected_value:
tag: Expected_value
value: host scientific name, taxonomy ID
description: Report the host's taxonomic name and/or NCBI taxonomy ID
title: host scientific name
examples:
- value: Homo sapiens and/or 9606
in_subset:
- nucleic acid sequence source
from_schema: https://w3id.org/mixs
keywords:
- host
- host.
string_serialization: '{text}|{NCBI taxid}'
slot_uri: MIXS:0000029
alias: specific_host
owner: MigsViHydrocarbonResourcesFluidsSwabs
domain_of:
- MigsBa
- MigsEu
- MigsPl
- MigsVi
- Miuvig
- Agriculture
range: string
recommended: true
env_medium:
name: env_medium
description: 'Report the environmental material(s) immediately surrounding the
sample or specimen at the time of sampling. We recommend using subclasses of
''environmental material'' (http://purl.obolibrary.org/obo/ENVO_00010483). EnvO
documentation about how to use the field: https://github.com/EnvironmentOntology/envo/wiki/Using-ENVO-with-MIxS
. Terms from other OBO ontologies are permissible as long as they reference
mass/volume nouns (e.g. air, water, blood) and not discrete, countable entities
(e.g. a tree, a leaf, a table top)'
title: environmental medium
examples:
- value: bluegrass field soil [ENVO:00005789]
in_subset:
- environment
from_schema: https://w3id.org/mixs
keywords:
- environmental
slot_uri: MIXS:0000014
alias: env_medium
owner: MigsViHydrocarbonResourcesFluidsSwabs
domain_of:
- MigsBa
- MigsEu
- MigsOrg
- MigsPl
- MigsVi
- Mimag
- MimarksC
- MimarksS
- Mims
- Misag
- Miuvig
range: string
required: true
structured_pattern:
syntax: ^{termLabel} \[{termID}\]$
interpolated: true
partial_match: true
samp_taxon_id:
name: samp_taxon_id
description: NCBI taxon id of the sample. Maybe be a single taxon or mixed taxa
sample. Use 'synthetic metagenome for mock community/positive controls, or
'blank sample' for negative controls
title: taxonomy ID of DNA sample
examples:
- value: Gut Metagenome [NCBITaxon:749906]
in_subset:
- investigation
from_schema: https://w3id.org/mixs
keywords:
- dna
- identifier
- sample
- taxon
slot_uri: MIXS:0001320
alias: samp_taxon_id
owner: MigsViHydrocarbonResourcesFluidsSwabs
domain_of:
- MigsBa
- MigsEu
- MigsOrg
- MigsPl
- MigsVi
- Mimag
- MimarksC
- MimarksS
- Mims
- Misag
- Miuvig
range: string
required: true
structured_pattern:
syntax: ^{text} \[{NCBItaxon_id}\]$
interpolated: true
partial_match: true
geo_loc_name:
name: geo_loc_name
description: The geographical origin of the sample as defined by the country or
sea name followed by specific region name. Country or sea names should be chosen
from the INSDC country list (http://insdc.org/country.html), or the GAZ ontology
(http://purl.bioontology.org/ontology/GAZ)
title: geographic location (country and/or sea,region)
examples:
- value: 'USA: Maryland, Bethesda'
in_subset:
- environment
from_schema: https://w3id.org/mixs
keywords:
- geographic
- location
slot_uri: MIXS:0000010
alias: geo_loc_name
owner: MigsViHydrocarbonResourcesFluidsSwabs
domain_of:
- MigsBa
- MigsEu
- MigsOrg
- MigsPl
- MigsVi
- Mimag
- MimarksC
- MimarksS
- Mims
- Misag
- Miuvig
- FoodAnimalAndAnimalFeed
- FoodFarmEnvironment
- FoodFoodProductionFacility
- FoodHumanFoods
- SymbiontAssociated
range: string
required: true
structured_pattern:
syntax: '^{country}: {region}, {specific_location}$'
interpolated: true
partial_match: true
collection_date:
name: collection_date
description: 'The time of sampling, either as an instance (single point in time)
or interval. In case no exact time is available, the date/time can be right
truncated i.e. all of these are valid times: 2008-01-23T19:23:10+00:00; 2008-01-23T19:23:10;
2008-01-23; 2008-01; 2008; Except: 2008-01; 2008 all are ISO8601 compliant'
title: collection date
examples:
- value: '2013-03-25T12:42:31+01:00'
in_subset:
- environment
from_schema: https://w3id.org/mixs
keywords:
- date
slot_uri: MIXS:0000011
alias: collection_date
owner: MigsViHydrocarbonResourcesFluidsSwabs
domain_of:
- MigsBa
- MigsEu
- MigsOrg
- MigsPl
- MigsVi
- Mimag
- MimarksC
- MimarksS
- Mims
- Misag
- Miuvig
- FoodAnimalAndAnimalFeed
- FoodFarmEnvironment
- FoodFoodProductionFacility
- FoodHumanFoods
- SymbiontAssociated
range: datetime
required: true
seq_meth:
name: seq_meth
description: Sequencing machine used. Where possible the term should be taken
from the OBI list of DNA sequencers (http://purl.obolibrary.org/obo/OBI_0400103)
title: sequencing method
examples:
- value: 454 Genome Sequencer FLX [OBI:0000702]
in_subset:
- sequencing
from_schema: https://w3id.org/mixs
keywords:
- method
slot_uri: MIXS:0000050
alias: seq_meth
owner: MigsViHydrocarbonResourcesFluidsSwabs
domain_of:
- MigsBa
- MigsEu
- MigsOrg
- MigsPl
- MigsVi
- Mimag
- MimarksC
- MimarksS
- Mims
- Misag
- Miuvig
- Agriculture
- FoodAnimalAndAnimalFeed
- FoodFarmEnvironment
- FoodFoodProductionFacility
- FoodHumanFoods
range: string
required: true
structured_pattern:
syntax: ^{text}|({termLabel} \[{termID}\])$
interpolated: true
partial_match: true
lat_lon:
name: lat_lon
description: The geographical origin of the sample as defined by latitude and
longitude. The values should be reported in decimal degrees, limited to 8 decimal
points, and in WGS84 system
title: geographic location (latitude and longitude)
examples:
- value: 50.586825 6.408977
in_subset:
- environment
from_schema: https://w3id.org/mixs
keywords:
- geographic
- location
slot_uri: MIXS:0000009
alias: lat_lon
owner: MigsViHydrocarbonResourcesFluidsSwabs
domain_of:
- MigsBa
- MigsEu
- MigsOrg
- MigsPl
- MigsVi
- Mimag
- MimarksC
- MimarksS
- Mims
- Misag
- Miuvig
- FoodAnimalAndAnimalFeed
- FoodFarmEnvironment
- FoodFoodProductionFacility
- FoodHumanFoods
- SymbiontAssociated
range: string
required: true
structured_pattern:
syntax: ^{lat} {lon}$
interpolated: true
partial_match: true
elev:
name: elev
annotations:
Preferred_unit:
tag: Preferred_unit
value: meter
description: Elevation of the sampling site is its height above a fixed reference
point, most commonly the mean sea level. Elevation is mainly used when referring
to points on the earth's surface, while altitude is used for points above the
surface, such as an aircraft in flight or a spacecraft in orbit
title: elevation
examples:
- value: 100 meter
in_subset:
- environment
from_schema: https://w3id.org/mixs
keywords:
- elevation
slot_uri: MIXS:0000093
alias: elev
owner: MigsViHydrocarbonResourcesFluidsSwabs
domain_of:
- MigsBa
- MigsEu
- MigsOrg
- MigsPl
- MigsVi
- Mimag
- MimarksC
- MimarksS
- Mims
- Misag
- Miuvig
- Agriculture
- Air
- HostAssociated
- HydrocarbonResourcesCores
- MicrobialMatBiofilm
- MiscellaneousNaturalOrArtificialEnvironment
- PlantAssociated
- Sediment
- Soil
- SymbiontAssociated
- Water
range: string
recommended: true
structured_pattern:
syntax: ^{scientific_float}( *- *{scientific_float})? *{text}$
interpolated: true
partial_match: true
env_broad_scale:
name: env_broad_scale
description: 'Report the major environmental system the sample or specimen came
from. The system(s) identified should have a coarse spatial grain, to provide
the general environmental context of where the sampling was done (e.g. in the
desert or a rainforest). We recommend using subclasses of EnvO s biome class: http://purl.obolibrary.org/obo/ENVO_00000428.
EnvO documentation about how to use the field: https://github.com/EnvironmentOntology/envo/wiki/Using-ENVO-with-MIxS'
title: broad-scale environmental context
examples:
- value: rangeland biome [ENVO:01000247]
in_subset:
- environment
from_schema: https://w3id.org/mixs
keywords:
- context
- environmental
slot_uri: MIXS:0000012
alias: env_broad_scale
owner: MigsViHydrocarbonResourcesFluidsSwabs
domain_of:
- MigsBa
- MigsEu
- MigsOrg
- MigsPl
- MigsVi
- Mimag
- MimarksC
- MimarksS
- Mims
- Misag
- Miuvig
range: string
required: true
structured_pattern:
syntax: ^{termLabel} \[{termID}\]$
interpolated: true
partial_match: true
tax_class:
name: tax_class
description: Method used for taxonomic classification, along with reference database
used, classification rank, and thresholds used to classify new genomes
title: taxonomic classification
examples:
- value: vConTACT vContact2 (references from NCBI RefSeq v83, genus rank classification,
default parameters)
in_subset:
- sequencing
from_schema: https://w3id.org/mixs
keywords:
- classification
- taxon
slot_uri: MIXS:0000064
alias: tax_class
owner: MigsViHydrocarbonResourcesFluidsSwabs
domain_of:
- MigsBa
- MigsEu
- MigsOrg
- MigsPl
- MigsVi
- Mimag
- Mims
- Misag
- Miuvig
range: string
experimental_factor:
name: experimental_factor
annotations:
Expected_value:
tag: Expected_value
value: text or EFO and/or OBI
description: Variable aspects of an experiment design that can be used to describe
an experiment, or set of experiments, in an increasingly detailed manner. This
field accepts ontology terms from Experimental Factor Ontology (EFO) and/or
Ontology for Biomedical Investigations (OBI)
title: experimental factor
examples:
- value: time series design [EFO:0001779]
in_subset:
- investigation
from_schema: https://w3id.org/mixs
keywords:
- experimental
- factor
string_serialization: '{termLabel} [{termID}]|{text}'
slot_uri: MIXS:0000008
alias: experimental_factor
owner: MigsViHydrocarbonResourcesFluidsSwabs
domain_of:
- MigsBa
- MigsEu
- MigsOrg
- MigsPl
- MigsVi
- Mimag
- MimarksC
- MimarksS
- Mims
- Misag
- Miuvig
- FoodAnimalAndAnimalFeed
- FoodFoodProductionFacility
- FoodHumanFoods
range: string
multivalued: true
pattern: ^\S+.*\S+ \[[a-zA-Z]{2,}:\d+\]$
associated_resource:
name: associated_resource
annotations:
Expected_value:
tag: Expected_value
value: reference to resource
description: A related resource that is referenced, cited, or otherwise associated
to the sequence
title: relevant electronic resources
examples:
- value: http://www.earthmicrobiome.org/
in_subset:
- sequencing
from_schema: https://w3id.org/mixs
keywords:
- resource
slot_uri: MIXS:0000091
alias: associated_resource
owner: MigsViHydrocarbonResourcesFluidsSwabs
domain_of:
- MigsBa
- MigsEu
- MigsOrg
- MigsPl
- MigsVi
- Mimag
- MimarksC
- MimarksS
- Mims
- Misag
- Miuvig
- Agriculture
range: string
recommended: true
multivalued: true
structured_pattern:
syntax: ^{PMID}|{DOI}|{URL}$
interpolated: true
sop:
name: sop
annotations:
Expected_value:
tag: Expected_value
value: reference to SOP
description: Standard operating procedures used in assembly and/or annotation
of genomes, metagenomes or environmental sequences
title: relevant standard operating procedures
examples:
- value: http://press.igsb.anl.gov/earthmicrobiome/protocols-and-standards/its/
in_subset:
- sequencing
from_schema: https://w3id.org/mixs
keywords:
- procedures
slot_uri: MIXS:0000090
alias: sop
owner: MigsViHydrocarbonResourcesFluidsSwabs
domain_of:
- MigsBa
- MigsEu
- MigsOrg
- MigsPl
- MigsVi
- Mimag
- MimarksC
- MimarksS
- Mims
- Misag
- Miuvig
- Agriculture
range: string
recommended: true
multivalued: true
structured_pattern:
syntax: ^{PMID}|{DOI}|{URL}$
interpolated: true
hcr:
name: hcr
description: Main Hydrocarbon Resource type. The term "Hydrocarbon Resource" HCR
defined as a natural environmental feature containing large amounts of hydrocarbons
at high concentrations potentially suitable for commercial exploitation. This
term should not be confused with the Hydrocarbon Occurrence term which also
includes hydrocarbon-rich environments with currently limited commercial interest
such as seeps, outcrops, gas hydrates etc. If "other" is specified, please propose
entry in "additional info" field
title: hydrocarbon resource type
examples:
- value: Oil Sand
from_schema: https://w3id.org/mixs
keywords:
- hydrocarbon
- resource
- type
slot_uri: MIXS:0000988
alias: hcr
owner: MigsViHydrocarbonResourcesFluidsSwabs
domain_of:
- HydrocarbonResourcesCores
- HydrocarbonResourcesFluidsSwabs
range: HcrEnum
required: true
hc_produced:
name: hc_produced
description: Main hydrocarbon type produced from resource (i.e. Oil, gas, condensate,
etc). If "other" is specified, please propose entry in "additional info" field
title: hydrocarbon type produced
examples:
- value: Gas
from_schema: https://w3id.org/mixs
keywords:
- hydrocarbon
- type
slot_uri: MIXS:0000989
alias: hc_produced
owner: MigsViHydrocarbonResourcesFluidsSwabs
domain_of:
- HydrocarbonResourcesCores
- HydrocarbonResourcesFluidsSwabs
range: HcProducedEnum
required: true
basin:
name: basin
description: Name of the basin (e.g. Campos)
title: basin name
examples:
- value: Campos
from_schema: https://w3id.org/mixs
slot_uri: MIXS:0000290
alias: basin
owner: MigsViHydrocarbonResourcesFluidsSwabs
domain_of:
- HydrocarbonResourcesCores
- HydrocarbonResourcesFluidsSwabs
range: string
required: true
field:
name: field
description: Name of the hydrocarbon field (e.g. Albacora)
title: field name
from_schema: https://w3id.org/mixs
slot_uri: MIXS:0000291
alias: field
owner: MigsViHydrocarbonResourcesFluidsSwabs
domain_of:
- HydrocarbonResourcesCores
- HydrocarbonResourcesFluidsSwabs
range: string
recommended: true
reservoir:
name: reservoir
description: Name of the reservoir (e.g. Carapebus)
title: reservoir name
from_schema: https://w3id.org/mixs
slot_uri: MIXS:0000303
alias: reservoir
owner: MigsViHydrocarbonResourcesFluidsSwabs
domain_of:
- HydrocarbonResourcesCores
- HydrocarbonResourcesFluidsSwabs
range: string
recommended: true
hcr_temp:
name: hcr_temp
annotations:
Preferred_unit:
tag: Preferred_unit
value: degree Celsius
description: Original temperature of the hydrocarbon resource
title: hydrocarbon resource original temperature
examples:
- value: 150-295 degree Celsius
from_schema: https://w3id.org/mixs
keywords:
- hydrocarbon
- resource
- temperature
slot_uri: MIXS:0000393
alias: hcr_temp
owner: MigsViHydrocarbonResourcesFluidsSwabs
domain_of:
- HydrocarbonResourcesCores
- HydrocarbonResourcesFluidsSwabs
range: string
recommended: true
structured_pattern:
syntax: ^{float} *- *{float} {unit}$
interpolated: true
partial_match: true
tvdss_of_hcr_temp:
name: tvdss_of_hcr_temp
annotations:
Preferred_unit:
tag: Preferred_unit
value: meter
description: True vertical depth subsea (TVDSS) of the hydrocarbon resource where
the original temperature was measured (e.g. 1345 m)
title: depth (TVDSS) of hydrocarbon resource temperature
from_schema: https://w3id.org/mixs
keywords:
- depth
- hydrocarbon
- resource
- temperature
slot_uri: MIXS:0000394
alias: tvdss_of_hcr_temp
owner: MigsViHydrocarbonResourcesFluidsSwabs
domain_of:
- HydrocarbonResourcesCores
- HydrocarbonResourcesFluidsSwabs
range: string
structured_pattern:
syntax: ^{scientific_float}( *- *{scientific_float})? *{text}$
interpolated: true
partial_match: true
hcr_pressure:
name: hcr_pressure
annotations:
Preferred_unit:
tag: Preferred_unit
value: atmosphere, kilopascal
description: Original pressure of the hydrocarbon resource
title: hydrocarbon resource original pressure
from_schema: https://w3id.org/mixs
keywords:
- hydrocarbon
- pressure
- resource
slot_uri: MIXS:0000395
alias: hcr_pressure
owner: MigsViHydrocarbonResourcesFluidsSwabs
domain_of:
- HydrocarbonResourcesCores
- HydrocarbonResourcesFluidsSwabs
range: string
structured_pattern:
syntax: ^{float} *- *{float} {unit}$
interpolated: true
partial_match: true
tvdss_of_hcr_press:
name: tvdss_of_hcr_press
annotations:
Preferred_unit:
tag: Preferred_unit
value: meter
description: True vertical depth subsea (TVDSS) of the hydrocarbon resource where
the original pressure was measured (e.g. 1578 m)
title: depth (TVDSS) of hydrocarbon resource pressure
from_schema: https://w3id.org/mixs
keywords:
- depth
- hydrocarbon
- pressure
- resource
slot_uri: MIXS:0000397
alias: tvdss_of_hcr_press
owner: MigsViHydrocarbonResourcesFluidsSwabs
domain_of:
- HydrocarbonResourcesCores
- HydrocarbonResourcesFluidsSwabs
range: string
structured_pattern:
syntax: ^{scientific_float}( *- *{scientific_float})? *{text}$
interpolated: true
partial_match: true
lithology:
name: lithology
description: 'Hydrocarbon resource main lithology (Additional information: http://petrowiki.org/Lithology_and_rock_type_determination).
If "other" is specified, please propose entry in "additional info" field'
title: lithology
examples:
- value: Volcanic
from_schema: https://w3id.org/mixs
keywords:
- lithology
slot_uri: MIXS:0000990
alias: lithology
owner: MigsViHydrocarbonResourcesFluidsSwabs
domain_of:
- HydrocarbonResourcesCores
- HydrocarbonResourcesFluidsSwabs
range: LithologyEnum
recommended: true
depos_env:
name: depos_env
description: Main depositional environment (https://en.wikipedia.org/wiki/Depositional_environment).
If "other" is specified, please propose entry in "additional info" field
title: depositional environment
examples:
- value: Marine - Reef
from_schema: https://w3id.org/mixs
keywords:
- environment
slot_uri: MIXS:0000992
alias: depos_env
owner: MigsViHydrocarbonResourcesFluidsSwabs
domain_of:
- HydrocarbonResourcesCores
- HydrocarbonResourcesFluidsSwabs
range: DeposEnvEnum
recommended: true
hcr_geol_age:
name: hcr_geol_age
description: 'Geological age of hydrocarbon resource (Additional info: https://en.wikipedia.org/wiki/Period_(geology)).
If "other" is specified, please propose entry in "additional info" field'
title: hydrocarbon resource geological age
examples:
- value: Silurian
from_schema: https://w3id.org/mixs
keywords:
- age
- hydrocarbon
- resource
slot_uri: MIXS:0000993
alias: hcr_geol_age
owner: MigsViHydrocarbonResourcesFluidsSwabs
domain_of:
- HydrocarbonResourcesCores
- HydrocarbonResourcesFluidsSwabs
range: GeolAgeEnum
recommended: true
hcr_fw_salinity:
name: hcr_fw_salinity
annotations:
Preferred_unit:
tag: Preferred_unit
value: milligram per liter
description: Original formation water salinity (prior to secondary recovery e.g.
Waterflooding) expressed as TDS
title: formation water salinity
from_schema: https://w3id.org/mixs
keywords:
- salinity
- water
slot_uri: MIXS:0000406
alias: hcr_fw_salinity
owner: MigsViHydrocarbonResourcesFluidsSwabs
domain_of:
- HydrocarbonResourcesCores
- HydrocarbonResourcesFluidsSwabs
range: string
recommended: true
structured_pattern:
syntax: ^{scientific_float}( *- *{scientific_float})? *{text}$
interpolated: true
partial_match: true
sulfate_fw:
name: sulfate_fw
annotations:
Preferred_unit:
tag: Preferred_unit
value: milligram per liter
description: Original sulfate concentration in the hydrocarbon resource
title: sulfate in formation water
from_schema: https://w3id.org/mixs
keywords:
- sulfate
- water
slot_uri: MIXS:0000407
alias: sulfate_fw
owner: MigsViHydrocarbonResourcesFluidsSwabs
domain_of:
- HydrocarbonResourcesCores
- HydrocarbonResourcesFluidsSwabs
range: string
recommended: true
structured_pattern:
syntax: ^{scientific_float}( *- *{scientific_float})? *{text}$
interpolated: true
partial_match: true
vfa_fw:
name: vfa_fw
annotations:
Preferred_unit:
tag: Preferred_unit
value: milligram per liter
description: Original volatile fatty acid concentration in the hydrocarbon resource
title: vfa in formation water
from_schema: https://w3id.org/mixs
keywords:
- water
slot_uri: MIXS:0000408
alias: vfa_fw
owner: MigsViHydrocarbonResourcesFluidsSwabs
domain_of:
- HydrocarbonResourcesCores
- HydrocarbonResourcesFluidsSwabs
range: string
recommended: true
structured_pattern:
syntax: ^{scientific_float}( *- *{scientific_float})? *{text}$
interpolated: true
partial_match: true
prod_start_date:
name: prod_start_date
description: Date of field's first production
title: production start date
examples:
- value: '2013-03-25T12:42:31+01:00'
from_schema: https://w3id.org/mixs
keywords:
- date
- production
- start
slot_uri: MIXS:0001008
alias: prod_start_date
owner: MigsViHydrocarbonResourcesFluidsSwabs
domain_of:
- HydrocarbonResourcesFluidsSwabs
range: datetime
recommended: true
prod_rate:
name: prod_rate
annotations:
Preferred_unit:
tag: Preferred_unit
value: cubic meter per day
description: Oil and/or gas production rates per well (e.g. 524 m3 / day)
title: production rate
from_schema: https://w3id.org/mixs
keywords:
- production
- rate
slot_uri: MIXS:0000452
alias: prod_rate
owner: MigsViHydrocarbonResourcesFluidsSwabs
domain_of:
- HydrocarbonResourcesFluidsSwabs
range: string
recommended: true
structured_pattern:
syntax: ^{scientific_float}( *- *{scientific_float})? *{text}$
interpolated: true
partial_match: true
water_prod_rate:
name: water_prod_rate
annotations:
Preferred_unit:
tag: Preferred_unit
value: cubic meter per day
description: Water production rates per well (e.g. 987 m3 / day)
title: water production rate
from_schema: https://w3id.org/mixs
keywords:
- production
- rate
- water
slot_uri: MIXS:0000453
alias: water_prod_rate
owner: MigsViHydrocarbonResourcesFluidsSwabs
domain_of:
- HydrocarbonResourcesFluidsSwabs
range: string
recommended: true
structured_pattern:
syntax: ^{scientific_float}( *- *{scientific_float})? *{text}$
interpolated: true
partial_match: true
water_cut:
name: water_cut
annotations:
Preferred_unit:
tag: Preferred_unit
value: percent
description: Current amount of water (%) in a produced fluid stream; or the average
of the combined streams
title: water cut
comments:
- percent or float?
examples:
- value: 45%
from_schema: https://w3id.org/mixs
keywords:
- water
slot_uri: MIXS:0000454
alias: water_cut
owner: MigsViHydrocarbonResourcesFluidsSwabs
domain_of:
- HydrocarbonResourcesFluidsSwabs
range: string
required: true
structured_pattern:
syntax: ^{scientific_float}( *- *{scientific_float})? *{text}$
interpolated: true
partial_match: true
iwf:
name: iwf
annotations:
Preferred_unit:
tag: Preferred_unit
value: percent
description: Proportion of the produced fluids derived from injected water at
the time of sampling. (e.g. 87%)
title: injection water fraction
comments:
- percent or float?
examples:
- value: '0.79'
from_schema: https://w3id.org/mixs
keywords:
- fraction
- water
slot_uri: MIXS:0000455
alias: iwf
owner: MigsViHydrocarbonResourcesFluidsSwabs
domain_of:
- HydrocarbonResourcesFluidsSwabs
range: float
required: true
structured_pattern:
syntax: ^{scientific_float}( *- *{scientific_float})? *{text}$
interpolated: true
partial_match: true
add_recov_method:
name: add_recov_method
description: Additional (i.e. Secondary, tertiary, etc.) recovery methods deployed
for increase of hydrocarbon recovery from resource and start date for each one
of them. If "other" is specified, please propose entry in "additional info"
field
title: secondary and tertiary recovery methods and start date
examples:
- value: Polymer Addition;2018-06-21T14:30Z
from_schema: https://w3id.org/mixs
keywords:
- date
- method
- recover
- secondary
- start
slot_uri: MIXS:0001009
alias: add_recov_method
owner: MigsViHydrocarbonResourcesFluidsSwabs
domain_of:
- HydrocarbonResourcesFluidsSwabs
range: string
required: true
structured_pattern:
syntax: ^({add_recov_methods});{date_time_stamp}$
interpolated: true
partial_match: true
iw_bt_date_well:
name: iw_bt_date_well
description: Injection water breakthrough date per well following a secondary
and/or tertiary recovery
title: injection water breakthrough date of specific well
examples:
- value: '2013-03-25T12:42:31+01:00'
from_schema: https://w3id.org/mixs
keywords:
- date
- water
slot_uri: MIXS:0001010
alias: iw_bt_date_well
owner: MigsViHydrocarbonResourcesFluidsSwabs
domain_of:
- HydrocarbonResourcesFluidsSwabs
range: datetime
biocide:
name: biocide
annotations:
Expected_value:
tag: Expected_value
value: name;name;timestamp
description: List of biocides (commercial name of product and supplier) and date
of administration
title: biocide administration
examples:
- value: ALPHA 1427;Baker Hughes;2008-01-23
from_schema: https://w3id.org/mixs
keywords:
- administration
string_serialization: '{text};{text};{timestamp}'
slot_uri: MIXS:0001011
alias: biocide
owner: MigsViHydrocarbonResourcesFluidsSwabs
domain_of:
- HydrocarbonResourcesFluidsSwabs
range: string
recommended: true
biocide_admin_method:
name: biocide_admin_method
annotations:
Expected_value:
tag: Expected_value
value: measurement value;frequency;duration;duration
Preferred_unit:
tag: Preferred_unit
value: milligram per liter
description: Method of biocide administration (dose, frequency, duration, time
elapsed between last biociding and sampling) (e.g. 150 mg/l; weekly; 4 hr; 3
days)
title: biocide administration method
from_schema: https://w3id.org/mixs
keywords:
- administration
- method
string_serialization: '{float} {unit};{Rn/start_time/end_time/duration};{duration}'
slot_uri: MIXS:0000456
alias: biocide_admin_method
owner: MigsViHydrocarbonResourcesFluidsSwabs
domain_of:
- HydrocarbonResourcesFluidsSwabs
range: string
recommended: true
chem_treatment:
name: chem_treatment
annotations:
Expected_value:
tag: Expected_value
value: name;name;timestamp
description: List of chemical compounds administered upstream the sampling location
where sampling occurred (e.g. Glycols, H2S scavenger, corrosion and scale inhibitors,
demulsifiers, and other production chemicals etc.). The commercial name of the
product and name of the supplier should be provided. The date of administration
should also be included
title: chemical treatment
examples:
- value: ACCENT 1125;DOW;2010-11-17
from_schema: https://w3id.org/mixs
keywords:
- treatment
string_serialization: '{text};{text};{timestamp}'
slot_uri: MIXS:0001012
alias: chem_treatment
owner: MigsViHydrocarbonResourcesFluidsSwabs
domain_of:
- HydrocarbonResourcesFluidsSwabs
range: string
chem_treat_method:
name: chem_treat_method
annotations:
Expected_value:
tag: Expected_value
value: measurement value;frequency;duration;duration
Preferred_unit:
tag: Preferred_unit
value: milligram per liter
description: Method of chemical administration(dose, frequency, duration, time
elapsed between administration and sampling) (e.g. 50 mg/l; twice a week; 1
hr; 0 days)
title: chemical treatment method
from_schema: https://w3id.org/mixs
keywords:
- method
- treatment
string_serialization: '{float} {unit};{Rn/start_time/end_time/duration};{duration};{duration}'
slot_uri: MIXS:0000457
alias: chem_treat_method
owner: MigsViHydrocarbonResourcesFluidsSwabs
domain_of:
- HydrocarbonResourcesFluidsSwabs
range: string
samp_loc_corr_rate:
name: samp_loc_corr_rate
annotations:
Preferred_unit:
tag: Preferred_unit
value: millimeter per year
description: Metal corrosion rate is the speed of metal deterioration due to environmental
conditions. As environmental conditions change corrosion rates change accordingly.
Therefore, long term corrosion rates are generally more informative than short
term rates and for that reason they are preferred during reporting. In the case
of suspected MIC, corrosion rate measurements at the time of sampling might
provide insights into the involvement of certain microbial community members
in MIC as well as potential microbial interplays
title: corrosion rate at sample location
from_schema: https://w3id.org/mixs
keywords:
- location
- rate
- sample
slot_uri: MIXS:0000136
alias: samp_loc_corr_rate
owner: MigsViHydrocarbonResourcesFluidsSwabs
domain_of:
- HydrocarbonResourcesFluidsSwabs
range: string
recommended: true
structured_pattern:
syntax: ^{float} *- *{float} {unit}$
interpolated: true
partial_match: true
samp_well_name:
name: samp_well_name
description: Name of the well (e.g. BXA1123) where sample was taken
title: sample well name
from_schema: https://w3id.org/mixs
keywords:
- sample
slot_uri: MIXS:0000296
alias: samp_well_name
owner: MigsViHydrocarbonResourcesFluidsSwabs
domain_of:
- HydrocarbonResourcesCores
- HydrocarbonResourcesFluidsSwabs
range: string
recommended: true
win:
name: win
description: 'A unique identifier of a well or wellbore. This is part of the Global
Framework for Well Identification initiative which is compiled by the Professional
Petroleum Data Management Association (PPDM) in an effort to improve well identification
systems. (Supporting information: https://ppdm.org/ and http://dl.ppdm.org/dl/690)'
title: well identification number
from_schema: https://w3id.org/mixs
keywords:
- identifier
- number
slot_uri: MIXS:0000297
alias: win
owner: MigsViHydrocarbonResourcesFluidsSwabs
domain_of:
- HydrocarbonResourcesCores
- HydrocarbonResourcesFluidsSwabs
range: string
recommended: true
samp_type:
name: samp_type
description: The type of material from which the sample was obtained. For the
Hydrocarbon package, samples include types like core, rock trimmings, drill
cuttings, piping section, coupon, pigging debris, solid deposit, produced fluid,
produced water, injected water, swabs, etc. For the Food Package, samples are
usually categorized as food, body products or tissues, or environmental material.
This field accepts terms listed under environmental specimen (http://purl.obolibrary.org/obo/GENEPIO_0001246)
title: sample type
examples:
- value: built environment sample [GENEPIO:0001248]
from_schema: https://w3id.org/mixs
keywords:
- sample
- type
slot_uri: MIXS:0000998
alias: samp_type
owner: MigsViHydrocarbonResourcesFluidsSwabs
domain_of:
- FoodFarmEnvironment
- FoodFoodProductionFacility
- HydrocarbonResourcesCores
- HydrocarbonResourcesFluidsSwabs
range: string
required: true
structured_pattern:
syntax: ^{termLabel} \[{termID}\]$
interpolated: true
partial_match: true
samp_subtype:
name: samp_subtype
description: Name of sample sub-type. For example if "sample type" is "Produced
Water" then subtype could be "Oil Phase" or "Water Phase". If "other" is specified,
please propose entry in "additional info" field
title: sample subtype
examples:
- value: biofilm
from_schema: https://w3id.org/mixs
keywords:
- sample
slot_uri: MIXS:0000999
alias: samp_subtype
owner: MigsViHydrocarbonResourcesFluidsSwabs
domain_of:
- HydrocarbonResourcesCores
- HydrocarbonResourcesFluidsSwabs
range: SampSubtypeEnum
recommended: true
samp_collect_point:
name: samp_collect_point
description: Sampling point on the asset were sample was collected (e.g. Wellhead,
storage tank, separator, etc). If "other" is specified, please propose entry
in "additional info" field
title: sample collection point
examples:
- value: well
from_schema: https://w3id.org/mixs
keywords:
- sample
slot_uri: MIXS:0001015
alias: samp_collect_point
owner: MigsViHydrocarbonResourcesFluidsSwabs
domain_of:
- HydrocarbonResourcesFluidsSwabs
range: SampCollectPointEnum
required: true
pressure:
name: pressure
annotations:
Preferred_unit:
tag: Preferred_unit
value: atmosphere
description: Pressure to which the sample is subject to, in atmospheres
title: pressure
examples:
- value: 50 atmosphere
from_schema: https://w3id.org/mixs
keywords:
- pressure
slot_uri: MIXS:0000412
alias: pressure
owner: MigsViHydrocarbonResourcesFluidsSwabs
domain_of:
- HydrocarbonResourcesCores
- HydrocarbonResourcesFluidsSwabs
- MicrobialMatBiofilm
- MiscellaneousNaturalOrArtificialEnvironment
- Sediment
- Water
range: string
structured_pattern:
syntax: ^{scientific_float}( *- *{scientific_float})? *{text}$
interpolated: true
partial_match: true
oxy_stat_samp:
name: oxy_stat_samp
description: Oxygenation status of sample
title: oxygenation status of sample
examples:
- value: aerobic
from_schema: https://w3id.org/mixs
keywords:
- oxygen
- sample
- status
slot_uri: MIXS:0000753
alias: oxy_stat_samp
owner: MigsViHydrocarbonResourcesFluidsSwabs
domain_of:
- Agriculture
- Air
- HostAssociated
- HumanAssociated
- HumanGut
- HumanOral
- HumanSkin
- HumanVaginal
- HydrocarbonResourcesCores
- HydrocarbonResourcesFluidsSwabs
- MicrobialMatBiofilm
- MiscellaneousNaturalOrArtificialEnvironment
- PlantAssociated
- Sediment
- SymbiontAssociated
- WastewaterSludge
- Water
range: OxyStatSampEnum
samp_preserv:
name: samp_preserv
annotations:
Preferred_unit:
tag: Preferred_unit
value: milliliter
description: Preservative added to the sample (e.g. Rnalater, alcohol, formaldehyde,
etc.). Where appropriate include volume added (e.g. Rnalater; 2 ml)
title: preservative added to sample
from_schema: https://w3id.org/mixs
keywords:
- sample
slot_uri: MIXS:0000463
alias: samp_preserv
owner: MigsViHydrocarbonResourcesFluidsSwabs
domain_of:
- HydrocarbonResourcesFluidsSwabs
range: string
structured_pattern:
syntax: ^{name};{float} {unit}$
interpolated: true
partial_match: true
samp_transport_cond:
name: samp_transport_cond
annotations:
Expected_value:
tag: Expected_value
value: measurement value;measurement value
Preferred_unit:
tag: Preferred_unit
value: days;degree Celsius
description: Sample transport duration (in days or hrs) and temperature the sample
was exposed to (e.g. 5.5 days; 20 C)
title: sample transport conditions
examples:
- value: 5 days;-20 degree Celsius
from_schema: https://w3id.org/mixs
keywords:
- condition
- sample
- transport
string_serialization: '{float} {unit};{float} {unit}'
slot_uri: MIXS:0000410
alias: samp_transport_cond
owner: MigsViHydrocarbonResourcesFluidsSwabs
domain_of:
- HydrocarbonResourcesCores
- HydrocarbonResourcesFluidsSwabs
range: string
samp_store_temp:
name: samp_store_temp
annotations:
Preferred_unit:
tag: Preferred_unit
value: degree Celsius
description: Temperature at which sample was stored, e.g. -80 degree Celsius
title: sample storage temperature
examples:
- value: -80 degree Celsius
from_schema: https://w3id.org/mixs
keywords:
- sample
- storage
- temperature
slot_uri: MIXS:0000110
alias: samp_store_temp
owner: MigsViHydrocarbonResourcesFluidsSwabs
domain_of:
- Agriculture
- Air
- FoodAnimalAndAnimalFeed
- FoodFarmEnvironment
- FoodFoodProductionFacility
- FoodHumanFoods
- HostAssociated
- HumanAssociated
- HumanGut
- HumanOral
- HumanSkin
- HumanVaginal
- HydrocarbonResourcesCores
- HydrocarbonResourcesFluidsSwabs
- MicrobialMatBiofilm
- MiscellaneousNaturalOrArtificialEnvironment
- PlantAssociated
- Sediment
- SymbiontAssociated
- WastewaterSludge
- Water
range: string
structured_pattern:
syntax: ^{scientific_float}( *- *{scientific_float})? *{text}$
interpolated: true
partial_match: true
samp_store_dur:
name: samp_store_dur
description: Duration for which the sample was stored. Indicate the duration for
which the sample was stored written in ISO 8601 format
title: sample storage duration
examples:
- value: P1Y6M
from_schema: https://w3id.org/mixs
keywords:
- duration
- period
- sample
- storage
slot_uri: MIXS:0000116
alias: samp_store_dur
owner: MigsViHydrocarbonResourcesFluidsSwabs
domain_of:
- Agriculture
- Air
- FoodAnimalAndAnimalFeed
- FoodFarmEnvironment
- FoodFoodProductionFacility
- FoodHumanFoods
- HostAssociated
- HumanAssociated
- HumanGut
- HumanOral
- HumanSkin
- HumanVaginal
- HydrocarbonResourcesCores
- HydrocarbonResourcesFluidsSwabs
- MicrobialMatBiofilm
- MiscellaneousNaturalOrArtificialEnvironment
- PlantAssociated
- Sediment
- SymbiontAssociated
- WastewaterSludge
- Water
range: string
structured_pattern:
syntax: ^{duration}$
interpolated: true
partial_match: true
samp_store_loc:
name: samp_store_loc
annotations:
Expected_value:
tag: Expected_value
value: location name
description: Location at which sample was stored, usually name of a specific freezer/room
title: sample storage location
examples:
- value: Freezer no:5
from_schema: https://w3id.org/mixs
keywords:
- location
- sample
- storage
slot_uri: MIXS:0000755
alias: samp_store_loc
owner: MigsViHydrocarbonResourcesFluidsSwabs
domain_of:
- Agriculture
- Air
- FoodAnimalAndAnimalFeed
- FoodFoodProductionFacility
- FoodHumanFoods
- HostAssociated
- HumanAssociated
- HumanGut
- HumanOral
- HumanSkin
- HumanVaginal
- HydrocarbonResourcesCores
- HydrocarbonResourcesFluidsSwabs
- MicrobialMatBiofilm
- MiscellaneousNaturalOrArtificialEnvironment
- PlantAssociated
- Sediment
- SymbiontAssociated
- WastewaterSludge
- Water
range: string
organism_count:
name: organism_count
annotations:
Expected_value:
tag: Expected_value
value: organism name;measurement value;enumeration
description: 'Total cell count of any organism (or group of organisms) per gram,
volume or area of sample, should include name of organism followed by count.
The method that was used for the enumeration (e.g. qPCR, atp, mpn, etc.) Should
also be provided. (example: total prokaryotes; 3.5e7 cells per ml; qpcr)'
title: organism count
examples:
- value: total prokaryotes;3.5e7 cells per milliliter;qPCR
from_schema: https://w3id.org/mixs
keywords:
- count
- organism
string_serialization: '{text};{float} {unit};[ATP|MPN|qPCR|other]'
slot_uri: MIXS:0000103
alias: organism_count
owner: MigsViHydrocarbonResourcesFluidsSwabs
domain_of:
- Agriculture
- Air
- BuiltEnvironment
- FoodAnimalAndAnimalFeed
- FoodFarmEnvironment
- FoodFoodProductionFacility
- FoodHumanFoods
- HostAssociated
- HumanAssociated
- HumanGut
- HumanOral
- HumanSkin
- HumanVaginal
- HydrocarbonResourcesCores
- HydrocarbonResourcesFluidsSwabs
- MicrobialMatBiofilm
- MiscellaneousNaturalOrArtificialEnvironment
- PlantAssociated
- Sediment
- SymbiontAssociated
- WastewaterSludge
- Water
range: string
recommended: true
multivalued: true
org_count_qpcr_info:
name: org_count_qpcr_info
annotations:
Expected_value:
tag: Expected_value
value: gene name;FWD:forward primer sequence;REV:reverse primer sequence;initial
denaturation:degrees_minutes;denaturation:degrees_minutes;annealing:degrees_minutes;elongation:degrees_minutes;final
elongation:degrees_minutes; total cycles
Preferred_unit:
tag: Preferred_unit
value: number of cells per gram (or ml or cm^2)
description: 'If qpcr was used for the cell count, the target gene name, the primer
sequence and the cycling conditions should also be provided. (Example: 16S rrna;
FWD:ACGTAGCTATGACGT REV:GTGCTAGTCGAGTAC; initial denaturation:90C_5min; denaturation:90C_2min;
annealing:52C_30 sec; elongation:72C_30 sec; 90 C for 1 min; final elongation:72C_5min;
30 cycles)'
title: organism count qPCR information
from_schema: https://w3id.org/mixs
keywords:
- count
- information
- organism
string_serialization: '{text};FWD:{dna};REV:{dna};initial denaturation:degrees_minutes;denaturation:degrees_minutes;annealing:degrees_minutes;elongation:degrees_minutes;final
elongation:degrees_minutes; total cycles'
slot_uri: MIXS:0000099
alias: org_count_qpcr_info
owner: MigsViHydrocarbonResourcesFluidsSwabs
domain_of:
- HydrocarbonResourcesCores
- HydrocarbonResourcesFluidsSwabs
range: string
ph:
name: ph
description: pH measurement of the sample, or liquid portion of sample, or aqueous
phase of the fluid
title: pH
examples:
- value: '7.2'
from_schema: https://w3id.org/mixs
keywords:
- ph
slot_uri: MIXS:0001001
alias: ph
owner: MigsViHydrocarbonResourcesFluidsSwabs
domain_of:
- FoodFarmEnvironment
- HydrocarbonResourcesCores
- HydrocarbonResourcesFluidsSwabs
- MicrobialMatBiofilm
- MiscellaneousNaturalOrArtificialEnvironment
- Sediment
- Soil
- WastewaterSludge
- Water
range: float
recommended: true
salinity:
name: salinity
annotations:
Preferred_unit:
tag: Preferred_unit
value: practical salinity unit, percentage
description: The total concentration of all dissolved salts in a liquid or solid
sample. While salinity can be measured by a complete chemical analysis, this
method is difficult and time consuming. More often, it is instead derived from
the conductivity measurement. This is known as practical salinity. These derivations
compare the specific conductance of the sample to a salinity standard such as
seawater
title: salinity
examples:
- value: 25 practical salinity unit
from_schema: https://w3id.org/mixs
keywords:
- salinity
slot_uri: MIXS:0000183
alias: salinity
owner: MigsViHydrocarbonResourcesFluidsSwabs
domain_of:
- Air
- FoodFarmEnvironment
- HostAssociated
- HumanAssociated
- HumanGut
- HumanOral
- HumanSkin
- HumanVaginal
- HydrocarbonResourcesCores
- HydrocarbonResourcesFluidsSwabs
- MicrobialMatBiofilm
- MiscellaneousNaturalOrArtificialEnvironment
- PlantAssociated
- Sediment
- SymbiontAssociated
- WastewaterSludge
- Water
range: string
structured_pattern:
syntax: ^{scientific_float}( *- *{scientific_float})? *{text}$
interpolated: true
partial_match: true
alkalinity:
name: alkalinity
annotations:
Preferred_unit:
tag: Preferred_unit
value: milliequivalent per liter, milligram per liter
description: Alkalinity, the ability of a solution to neutralize acids to the
equivalence point of carbonate or bicarbonate
title: alkalinity
examples:
- value: 50 milligram per liter
from_schema: https://w3id.org/mixs
keywords:
- alkalinity
slot_uri: MIXS:0000421
alias: alkalinity
owner: MigsViHydrocarbonResourcesFluidsSwabs
domain_of:
- HydrocarbonResourcesCores
- HydrocarbonResourcesFluidsSwabs
- MicrobialMatBiofilm
- MiscellaneousNaturalOrArtificialEnvironment
- Sediment
- WastewaterSludge
- Water
range: string
structured_pattern:
syntax: ^{scientific_float}( *- *{scientific_float})? *{text}$
interpolated: true
partial_match: true
alkalinity_method:
name: alkalinity_method
description: Method used for alkalinity measurement
title: alkalinity method
examples:
- value: titration
from_schema: https://w3id.org/mixs
keywords:
- alkalinity
- method
slot_uri: MIXS:0000298
alias: alkalinity_method
owner: MigsViHydrocarbonResourcesFluidsSwabs
domain_of:
- HydrocarbonResourcesCores
- HydrocarbonResourcesFluidsSwabs
- Water
range: string
sulfate:
name: sulfate
annotations:
Preferred_unit:
tag: Preferred_unit
value: micromole per liter, milligram per liter, parts per million
description: Concentration of sulfate in the sample
title: sulfate
examples:
- value: 5 micromole per liter
from_schema: https://w3id.org/mixs
keywords:
- sulfate
slot_uri: MIXS:0000423
alias: sulfate
owner: MigsViHydrocarbonResourcesFluidsSwabs
domain_of:
- HydrocarbonResourcesCores
- HydrocarbonResourcesFluidsSwabs
- MicrobialMatBiofilm
- MiscellaneousNaturalOrArtificialEnvironment
- Sediment
- Water
range: string
required: true
structured_pattern:
syntax: ^{scientific_float}( *- *{scientific_float})? *{text}$
interpolated: true
partial_match: true
sulfide:
name: sulfide
annotations:
Preferred_unit:
tag: Preferred_unit
value: micromole per liter, milligram per liter, parts per million
description: Concentration of sulfide in the sample
title: sulfide
examples:
- value: 2 micromole per liter
from_schema: https://w3id.org/mixs
keywords:
- sulfide
slot_uri: MIXS:0000424
alias: sulfide
owner: MigsViHydrocarbonResourcesFluidsSwabs
domain_of:
- HydrocarbonResourcesCores
- HydrocarbonResourcesFluidsSwabs
- MicrobialMatBiofilm
- MiscellaneousNaturalOrArtificialEnvironment
- Sediment
- Water
range: string
required: true
structured_pattern:
syntax: ^{scientific_float}( *- *{scientific_float})? *{text}$
interpolated: true
partial_match: true
tot_sulfur:
name: tot_sulfur
annotations:
Preferred_unit:
tag: Preferred_unit
value: milligram per liter, parts per million
description: Concentration of total sulfur in the sample
title: total sulfur
from_schema: https://w3id.org/mixs
keywords:
- sulfur
- total
slot_uri: MIXS:0000419
alias: tot_sulfur
owner: MigsViHydrocarbonResourcesFluidsSwabs
domain_of:
- HydrocarbonResourcesCores
- HydrocarbonResourcesFluidsSwabs
range: string
recommended: true
structured_pattern:
syntax: ^{scientific_float}( *- *{scientific_float})? *{text}$
interpolated: true
partial_match: true
nitrate:
name: nitrate
annotations:
Preferred_unit:
tag: Preferred_unit
value: micromole per liter, milligram per liter, parts per million
description: Concentration of nitrate in the sample
title: nitrate
examples:
- value: 65 micromole per liter
from_schema: https://w3id.org/mixs
keywords:
- nitrate
slot_uri: MIXS:0000425
alias: nitrate
owner: MigsViHydrocarbonResourcesFluidsSwabs
domain_of:
- HydrocarbonResourcesCores
- HydrocarbonResourcesFluidsSwabs
- MicrobialMatBiofilm
- MiscellaneousNaturalOrArtificialEnvironment
- Sediment
- WastewaterSludge
- Water
range: string
required: true
structured_pattern:
syntax: ^{scientific_float}( *- *{scientific_float})? *{text}$
interpolated: true
partial_match: true
nitrite:
name: nitrite
annotations:
Preferred_unit:
tag: Preferred_unit
value: micromole per liter, milligram per liter, parts per million
description: Concentration of nitrite in the sample
title: nitrite
examples:
- value: 0.5 micromole per liter
from_schema: https://w3id.org/mixs
keywords:
- nitrite
slot_uri: MIXS:0000426
alias: nitrite
owner: MigsViHydrocarbonResourcesFluidsSwabs
domain_of:
- HydrocarbonResourcesCores
- HydrocarbonResourcesFluidsSwabs
- MicrobialMatBiofilm
- MiscellaneousNaturalOrArtificialEnvironment
- Sediment
- Water
range: string
recommended: true
structured_pattern:
syntax: ^{scientific_float}( *- *{scientific_float})? *{text}$
interpolated: true
partial_match: true
ammonium:
name: ammonium
annotations:
Preferred_unit:
tag: Preferred_unit
value: micromole per liter, milligram per liter, parts per million
description: Concentration of ammonium in the sample
title: ammonium
examples:
- value: 1.5 milligram per liter
from_schema: https://w3id.org/mixs
slot_uri: MIXS:0000427
alias: ammonium
owner: MigsViHydrocarbonResourcesFluidsSwabs
domain_of:
- HydrocarbonResourcesCores
- HydrocarbonResourcesFluidsSwabs
- MicrobialMatBiofilm
- MiscellaneousNaturalOrArtificialEnvironment
- Sediment
- Water
range: string
recommended: true
structured_pattern:
syntax: ^{scientific_float}( *- *{scientific_float})? *{text}$
interpolated: true
partial_match: true
tot_nitro:
name: tot_nitro
annotations:
Preferred_unit:
tag: Preferred_unit
value: microgram per liter, micromole per liter, milligram per liter
description: 'Total nitrogen concentration of water samples, calculated by: total
nitrogen = total dissolved nitrogen + particulate nitrogen. Can also be measured
without filtering, reported as nitrogen'
title: total nitrogen concentration
examples:
- value: 50 micromole per liter
from_schema: https://w3id.org/mixs
keywords:
- concentration
- nitrogen
- total
slot_uri: MIXS:0000102
alias: tot_nitro
owner: MigsViHydrocarbonResourcesFluidsSwabs
domain_of:
- HydrocarbonResourcesCores
- HydrocarbonResourcesFluidsSwabs
- WastewaterSludge
- Water
range: string
structured_pattern:
syntax: ^{scientific_float}( *- *{scientific_float})? *{text}$
interpolated: true
partial_match: true
diss_iron:
name: diss_iron
annotations:
Preferred_unit:
tag: Preferred_unit
value: milligram per liter
description: Concentration of dissolved iron in the sample
title: dissolved iron
from_schema: https://w3id.org/mixs
keywords:
- dissolved
slot_uri: MIXS:0000139
alias: diss_iron
owner: MigsViHydrocarbonResourcesFluidsSwabs
domain_of:
- HydrocarbonResourcesCores
- HydrocarbonResourcesFluidsSwabs
range: string
recommended: true
structured_pattern:
syntax: ^{scientific_float}( *- *{scientific_float})? *{text}$
interpolated: true
partial_match: true
sodium:
name: sodium
annotations:
Preferred_unit:
tag: Preferred_unit
value: milligram per liter, parts per million
description: Sodium concentration in the sample
title: sodium
examples:
- value: 10.5 milligram per liter
from_schema: https://w3id.org/mixs
slot_uri: MIXS:0000428
alias: sodium
owner: MigsViHydrocarbonResourcesFluidsSwabs
domain_of:
- HydrocarbonResourcesCores
- HydrocarbonResourcesFluidsSwabs
- MicrobialMatBiofilm
- MiscellaneousNaturalOrArtificialEnvironment
- Sediment
- WastewaterSludge
- Water
range: string
structured_pattern:
syntax: ^{scientific_float}( *- *{scientific_float})? *{text}$
interpolated: true
partial_match: true
chloride:
name: chloride
annotations:
Preferred_unit:
tag: Preferred_unit
value: milligram per liter, parts per million
description: Concentration of chloride in the sample
title: chloride
examples:
- value: 5000 milligram per liter
from_schema: https://w3id.org/mixs
slot_uri: MIXS:0000429
alias: chloride
owner: MigsViHydrocarbonResourcesFluidsSwabs
domain_of:
- HydrocarbonResourcesCores
- HydrocarbonResourcesFluidsSwabs
- MicrobialMatBiofilm
- MiscellaneousNaturalOrArtificialEnvironment
- Sediment
- Water
range: string
structured_pattern:
syntax: ^{scientific_float}( *- *{scientific_float})? *{text}$
interpolated: true
partial_match: true
potassium:
name: potassium
annotations:
Preferred_unit:
tag: Preferred_unit
value: milligram per liter, parts per million
description: Concentration of potassium in the sample
title: potassium
examples:
- value: 463 milligram per liter
from_schema: https://w3id.org/mixs
slot_uri: MIXS:0000430
alias: potassium
owner: MigsViHydrocarbonResourcesFluidsSwabs
domain_of:
- HydrocarbonResourcesCores
- HydrocarbonResourcesFluidsSwabs
- MicrobialMatBiofilm
- MiscellaneousNaturalOrArtificialEnvironment
- Sediment
- Water
range: string
structured_pattern:
syntax: ^{scientific_float}( *- *{scientific_float})? *{text}$
interpolated: true
partial_match: true
magnesium:
name: magnesium
annotations:
Preferred_unit:
tag: Preferred_unit
value: mole per liter, milligram per liter, parts per million, micromole per
kilogram
description: Concentration of magnesium in the sample
title: magnesium
examples:
- value: 52.8 micromole per kilogram
from_schema: https://w3id.org/mixs
slot_uri: MIXS:0000431
alias: magnesium
owner: MigsViHydrocarbonResourcesFluidsSwabs
domain_of:
- HydrocarbonResourcesCores
- HydrocarbonResourcesFluidsSwabs
- MicrobialMatBiofilm
- Sediment
- Water
range: string
structured_pattern:
syntax: ^{scientific_float}( *- *{scientific_float})? *{text}$
interpolated: true
partial_match: true
calcium:
name: calcium
annotations:
Preferred_unit:
tag: Preferred_unit
value: milligram per liter, micromole per liter, parts per million
description: Concentration of calcium in the sample
title: calcium
examples:
- value: 0.2 micromole per liter
from_schema: https://w3id.org/mixs
slot_uri: MIXS:0000432
alias: calcium
owner: MigsViHydrocarbonResourcesFluidsSwabs
domain_of:
- HydrocarbonResourcesCores
- HydrocarbonResourcesFluidsSwabs
- MicrobialMatBiofilm
- MiscellaneousNaturalOrArtificialEnvironment
- Sediment
- Water
range: string
structured_pattern:
syntax: ^{scientific_float}( *- *{scientific_float})? *{text}$
interpolated: true
partial_match: true
tot_iron:
name: tot_iron
annotations:
Preferred_unit:
tag: Preferred_unit
value: milligram per liter, milligram per kilogram
description: Concentration of total iron in the sample
title: total iron
from_schema: https://w3id.org/mixs
keywords:
- total
slot_uri: MIXS:0000105
alias: tot_iron
owner: MigsViHydrocarbonResourcesFluidsSwabs
domain_of:
- HydrocarbonResourcesCores
- HydrocarbonResourcesFluidsSwabs
range: string
recommended: true
structured_pattern:
syntax: ^{scientific_float}( *- *{scientific_float})? *{text}$
interpolated: true
partial_match: true
diss_org_carb:
name: diss_org_carb
annotations:
Preferred_unit:
tag: Preferred_unit
value: micromole per liter, milligram per liter
description: Concentration of dissolved organic carbon in the sample, liquid portion
of the sample, or aqueous phase of the fluid
title: dissolved organic carbon
examples:
- value: 197 micromole per liter
from_schema: https://w3id.org/mixs
keywords:
- carbon
- dissolved
- organic
slot_uri: MIXS:0000433
alias: diss_org_carb
owner: MigsViHydrocarbonResourcesFluidsSwabs
domain_of:
- HydrocarbonResourcesCores
- HydrocarbonResourcesFluidsSwabs
- MicrobialMatBiofilm
- Sediment
- Water
range: string
structured_pattern:
syntax: ^{scientific_float}( *- *{scientific_float})? *{text}$
interpolated: true
partial_match: true
diss_inorg_carb:
name: diss_inorg_carb
annotations:
Preferred_unit:
tag: Preferred_unit
value: microgram per liter, milligram per liter, parts per million
description: Dissolved inorganic carbon concentration in the sample, typically
measured after filtering the sample using a 0.45 micrometer filter
title: dissolved inorganic carbon
examples:
- value: 2059 micromole per kilogram
from_schema: https://w3id.org/mixs
keywords:
- carbon
- dissolved
- inorganic
slot_uri: MIXS:0000434
alias: diss_inorg_carb
owner: MigsViHydrocarbonResourcesFluidsSwabs
domain_of:
- HydrocarbonResourcesCores
- HydrocarbonResourcesFluidsSwabs
- MicrobialMatBiofilm
- MiscellaneousNaturalOrArtificialEnvironment
- Sediment
- Water
range: string
structured_pattern:
syntax: ^{scientific_float}( *- *{scientific_float})? *{text}$
interpolated: true
partial_match: true
diss_inorg_phosp:
name: diss_inorg_phosp
description: Concentration of dissolved inorganic phosphorus in the sample
title: dissolved inorganic phosphorus
examples:
- value: 56.5 micromole per liter
from_schema: https://w3id.org/mixs
keywords:
- dissolved
- inorganic
- phosphorus
slot_uri: MIXS:0000106
alias: diss_inorg_phosp
owner: MigsViHydrocarbonResourcesFluidsSwabs
domain_of:
- HydrocarbonResourcesCores
- HydrocarbonResourcesFluidsSwabs
- Water
range: string
recommended: true
structured_pattern:
syntax: ^{scientific_float}( *- *{scientific_float})? *{text}$
interpolated: true
partial_match: true
tot_phosp:
name: tot_phosp
annotations:
Preferred_unit:
tag: Preferred_unit
value: micromole per liter, milligram per liter, parts per million
description: 'Total phosphorus concentration in the sample, calculated by: total
phosphorus = total dissolved phosphorus + particulate phosphorus'
title: total phosphorus
examples:
- value: 0.03 milligram per liter
from_schema: https://w3id.org/mixs
keywords:
- phosphorus
- total
slot_uri: MIXS:0000117
alias: tot_phosp
owner: MigsViHydrocarbonResourcesFluidsSwabs
domain_of:
- HydrocarbonResourcesCores
- HydrocarbonResourcesFluidsSwabs
- Water
range: string
structured_pattern:
syntax: ^{scientific_float}( *- *{scientific_float})? *{text}$
interpolated: true
partial_match: true
suspend_solids:
name: suspend_solids
annotations:
Expected_value:
tag: Expected_value
value: suspended solid name;measurement value
Preferred_unit:
tag: Preferred_unit
value: gram, microgram, milligram per liter, mole per liter, gram per liter,
part per million
description: Concentration of substances including a wide variety of material,
such as silt, decaying plant and animal matter; can include multiple substances
title: suspended solids
from_schema: https://w3id.org/mixs
keywords:
- solids
- suspended
string_serialization: '{text};{float} {unit}'
slot_uri: MIXS:0000150
alias: suspend_solids
owner: MigsViHydrocarbonResourcesFluidsSwabs
domain_of:
- HydrocarbonResourcesCores
- HydrocarbonResourcesFluidsSwabs
- WastewaterSludge
range: string
multivalued: true
density:
name: density
annotations:
Preferred_unit:
tag: Preferred_unit
value: gram per cubic meter, gram per cubic centimeter
description: Density of the sample, which is its mass per unit volume (aka volumetric
mass density)
title: density
examples:
- value: 1000 kilogram per cubic meter
from_schema: https://w3id.org/mixs
keywords:
- density
slot_uri: MIXS:0000435
alias: density
owner: MigsViHydrocarbonResourcesFluidsSwabs
domain_of:
- HydrocarbonResourcesCores
- HydrocarbonResourcesFluidsSwabs
- MiscellaneousNaturalOrArtificialEnvironment
- Sediment
- Water
range: string
structured_pattern:
syntax: ^{scientific_float}( *- *{scientific_float})? *{text}$
interpolated: true
partial_match: true
diss_carb_dioxide:
name: diss_carb_dioxide
annotations:
Preferred_unit:
tag: Preferred_unit
value: micromole per liter, milligram per liter
description: Concentration of dissolved carbon dioxide in the sample or liquid
portion of the sample
title: dissolved carbon dioxide
examples:
- value: 5 milligram per liter
from_schema: https://w3id.org/mixs
keywords:
- carbon
- dissolved
slot_uri: MIXS:0000436
alias: diss_carb_dioxide
owner: MigsViHydrocarbonResourcesFluidsSwabs
domain_of:
- HydrocarbonResourcesCores
- HydrocarbonResourcesFluidsSwabs
- MicrobialMatBiofilm
- MiscellaneousNaturalOrArtificialEnvironment
- Sediment
- Water
range: string
structured_pattern:
syntax: ^{scientific_float}( *- *{scientific_float})? *{text}$
interpolated: true
partial_match: true
diss_oxygen_fluid:
name: diss_oxygen_fluid
annotations:
Preferred_unit:
tag: Preferred_unit
value: micromole per kilogram, milligram per liter
description: Concentration of dissolved oxygen in the oil field produced fluids
as it contributes to oxygen-corrosion and microbial activity (e.g. Mic)
title: dissolved oxygen in fluids
from_schema: https://w3id.org/mixs
keywords:
- dissolved
- oxygen
slot_uri: MIXS:0000438
alias: diss_oxygen_fluid
owner: MigsViHydrocarbonResourcesFluidsSwabs
domain_of:
- HydrocarbonResourcesCores
- HydrocarbonResourcesFluidsSwabs
range: string
structured_pattern:
syntax: ^{scientific_float}( *- *{scientific_float})? *{text}$
interpolated: true
partial_match: true
vfa:
name: vfa
annotations:
Preferred_unit:
tag: Preferred_unit
value: milligram per liter, parts per million
description: Concentration of Volatile Fatty Acids in the sample
title: volatile fatty acids
from_schema: https://w3id.org/mixs
slot_uri: MIXS:0000152
alias: vfa
owner: MigsViHydrocarbonResourcesFluidsSwabs
domain_of:
- HydrocarbonResourcesCores
- HydrocarbonResourcesFluidsSwabs
range: string
recommended: true
structured_pattern:
syntax: ^{scientific_float}( *- *{scientific_float})? *{text}$
interpolated: true
partial_match: true
benzene:
name: benzene
annotations:
Preferred_unit:
tag: Preferred_unit
value: milligram per liter, parts per million
description: Concentration of benzene in the sample
title: benzene
from_schema: https://w3id.org/mixs
slot_uri: MIXS:0000153
alias: benzene
owner: MigsViHydrocarbonResourcesFluidsSwabs
domain_of:
- HydrocarbonResourcesCores
- HydrocarbonResourcesFluidsSwabs
range: string
recommended: true
structured_pattern:
syntax: ^{scientific_float}( *- *{scientific_float})? *{text}$
interpolated: true
partial_match: true
toluene:
name: toluene
annotations:
Preferred_unit:
tag: Preferred_unit
value: milligram per liter, parts per million
description: Concentration of toluene in the sample
title: toluene
from_schema: https://w3id.org/mixs
slot_uri: MIXS:0000154
alias: toluene
owner: MigsViHydrocarbonResourcesFluidsSwabs
domain_of:
- HydrocarbonResourcesCores
- HydrocarbonResourcesFluidsSwabs
range: string
recommended: true
structured_pattern:
syntax: ^{scientific_float}( *- *{scientific_float})? *{text}$
interpolated: true
partial_match: true
ethylbenzene:
name: ethylbenzene
annotations:
Preferred_unit:
tag: Preferred_unit
value: milligram per liter, parts per million
description: Concentration of ethylbenzene in the sample
title: ethylbenzene
from_schema: https://w3id.org/mixs
slot_uri: MIXS:0000155
alias: ethylbenzene
owner: MigsViHydrocarbonResourcesFluidsSwabs
domain_of:
- HydrocarbonResourcesCores
- HydrocarbonResourcesFluidsSwabs
range: string
recommended: true
structured_pattern:
syntax: ^{scientific_float}( *- *{scientific_float})? *{text}$
interpolated: true
partial_match: true
xylene:
name: xylene
annotations:
Preferred_unit:
tag: Preferred_unit
value: milligram per liter, parts per million
description: Concentration of xylene in the sample
title: xylene
from_schema: https://w3id.org/mixs
slot_uri: MIXS:0000156
alias: xylene
owner: MigsViHydrocarbonResourcesFluidsSwabs
domain_of:
- HydrocarbonResourcesCores
- HydrocarbonResourcesFluidsSwabs
range: string
recommended: true
structured_pattern:
syntax: ^{scientific_float}( *- *{scientific_float})? *{text}$
interpolated: true
partial_match: true
api:
name: api
annotations:
Preferred_unit:
tag: Preferred_unit
value: degrees API
description: 'API gravity is a measure of how heavy or light a petroleum liquid
is compared to water (source: https://en.wikipedia.org/wiki/API_gravity) (e.g.
31.1 API)'
title: API gravity
examples:
- value: 31.1 API
from_schema: https://w3id.org/mixs
slot_uri: MIXS:0000157
alias: api
owner: MigsViHydrocarbonResourcesFluidsSwabs
domain_of:
- HydrocarbonResourcesCores
- HydrocarbonResourcesFluidsSwabs
range: string
required: true
structured_pattern:
syntax: ^{scientific_float}( *- *{scientific_float})? *{text}$
interpolated: true
partial_match: true
tan:
name: tan
annotations:
Preferred_unit:
tag: Preferred_unit
value: milligram per liter
description: 'Total Acid Number (TAN) is a measurement of acidity that is determined
by the amount of potassium hydroxide in milligrams that is needed to neutralize
the acids in one gram of oil. It is an important quality measurement of crude
oil. (source: https://en.wikipedia.org/wiki/Total_acid_number)'
title: total acid number
from_schema: https://w3id.org/mixs
keywords:
- number
- total
slot_uri: MIXS:0000120
alias: tan
owner: MigsViHydrocarbonResourcesFluidsSwabs
domain_of:
- HydrocarbonResourcesCores
- HydrocarbonResourcesFluidsSwabs
range: string
recommended: true
structured_pattern:
syntax: ^{scientific_float}( *- *{scientific_float})? *{text}$
interpolated: true
partial_match: true
viscosity:
name: viscosity
annotations:
Expected_value:
tag: Expected_value
value: measurement value;measurement value
Preferred_unit:
tag: Preferred_unit
value: cP at degree Celsius
description: A measure of oil's resistance to gradual deformation by shear stress or tensile
stress (e.g. 3.5 cp; 100 C)
title: viscosity
from_schema: https://w3id.org/mixs
string_serialization: '{float} {unit};{float} {unit}'
slot_uri: MIXS:0000126
alias: viscosity
owner: MigsViHydrocarbonResourcesFluidsSwabs
domain_of:
- HydrocarbonResourcesCores
- HydrocarbonResourcesFluidsSwabs
range: string
pour_point:
name: pour_point
annotations:
Preferred_unit:
tag: Preferred_unit
value: degree Celsius
description: 'Temperature at which a liquid becomes semi solid and loses its flow
characteristics. In crude oil a high pour point is generally associated with
a high paraffin content, typically found in crude deriving from a larger proportion
of plant material. (soure: https://en.wikipedia.org/wiki/pour_point)'
title: pour point
from_schema: https://w3id.org/mixs
slot_uri: MIXS:0000127
alias: pour_point
owner: MigsViHydrocarbonResourcesFluidsSwabs
domain_of:
- HydrocarbonResourcesCores
- HydrocarbonResourcesFluidsSwabs
range: string
structured_pattern:
syntax: ^{scientific_float}( *- *{scientific_float})? *{text}$
interpolated: true
partial_match: true
saturates_pc:
name: saturates_pc
annotations:
Preferred_unit:
tag: Preferred_unit
value: percent
description: 'Saturate, Aromatic, Resin and Asphaltene (SARA) is an analysis
method that divides crude oil components according to their polarizability
and polarity. There are three main methods to obtain SARA results. The most
popular one is known as the Iatroscan TLC-FID and is referred to as IP-143 (source:
https://en.wikipedia.org/wiki/Saturate,_aromatic,_resin_and_asphaltene)'
title: saturates wt%
from_schema: https://w3id.org/mixs
slot_uri: MIXS:0000131
alias: saturates_pc
owner: MigsViHydrocarbonResourcesFluidsSwabs
domain_of:
- HydrocarbonResourcesCores
- HydrocarbonResourcesFluidsSwabs
range: string
recommended: true
structured_pattern:
syntax: ^{name};{float} {unit}$
interpolated: true
partial_match: true
aromatics_pc:
name: aromatics_pc
annotations:
Preferred_unit:
tag: Preferred_unit
value: percent
description: 'Saturate, Aromatic, Resin and Asphaltene (SARA) is an analysis
method that divides crude oil components according to their polarizability
and polarity. There are three main methods to obtain SARA results. The most
popular one is known as the Iatroscan TLC-FID and is referred to as IP-143 (source:
https://en.wikipedia.org/wiki/Saturate,_aromatic,_resin_and_asphaltene)'
title: aromatics wt%
from_schema: https://w3id.org/mixs
slot_uri: MIXS:0000133
alias: aromatics_pc
owner: MigsViHydrocarbonResourcesFluidsSwabs
domain_of:
- HydrocarbonResourcesCores
- HydrocarbonResourcesFluidsSwabs
range: string
recommended: true
structured_pattern:
syntax: ^{name};{float} {unit}$
interpolated: true
partial_match: true
resins_pc:
name: resins_pc
annotations:
Preferred_unit:
tag: Preferred_unit
value: percent
description: 'Saturate, Aromatic, Resin and Asphaltene (SARA) is an analysis
method that divides crude oil components according to their polarizability
and polarity. There are three main methods to obtain SARA results. The most
popular one is known as the Iatroscan TLC-FID and is referred to as IP-143 (source:
https://en.wikipedia.org/wiki/Saturate,_aromatic,_resin_and_asphaltene)'
title: resins wt%
from_schema: https://w3id.org/mixs
slot_uri: MIXS:0000134
alias: resins_pc
owner: MigsViHydrocarbonResourcesFluidsSwabs
domain_of:
- HydrocarbonResourcesCores
- HydrocarbonResourcesFluidsSwabs
range: string
recommended: true
structured_pattern:
syntax: ^{name};{float} {unit}$
interpolated: true
partial_match: true
asphaltenes_pc:
name: asphaltenes_pc
annotations:
Preferred_unit:
tag: Preferred_unit
value: percent
description: 'Saturate, Aromatic, Resin and Asphaltene (SARA) is an analysis
method that divides crude oil components according to their polarizability
and polarity. There are three main methods to obtain SARA results. The most
popular one is known as the Iatroscan TLC-FID and is referred to as IP-143 (source:
https://en.wikipedia.org/wiki/Saturate,_aromatic,_resin_and_asphaltene)'
title: asphaltenes wt%
from_schema: https://w3id.org/mixs
slot_uri: MIXS:0000135
alias: asphaltenes_pc
owner: MigsViHydrocarbonResourcesFluidsSwabs
domain_of:
- HydrocarbonResourcesCores
- HydrocarbonResourcesFluidsSwabs
range: string
recommended: true
structured_pattern:
syntax: ^{name};{float} {unit}$
interpolated: true
partial_match: true
misc_param:
name: misc_param
annotations:
Expected_value:
tag: Expected_value
value: parameter name;measurement value
description: Any other measurement performed or parameter collected, that is not
listed here
title: miscellaneous parameter
examples:
- value: Bicarbonate ion concentration;2075 micromole per kilogram
from_schema: https://w3id.org/mixs
keywords:
- parameter
string_serialization: '{text};{float} {unit}'
slot_uri: MIXS:0000752
alias: misc_param
owner: MigsViHydrocarbonResourcesFluidsSwabs
domain_of:
- Agriculture
- Air
- FoodAnimalAndAnimalFeed
- FoodFarmEnvironment
- FoodFoodProductionFacility
- FoodHumanFoods
- HostAssociated
- HumanAssociated
- HumanGut
- HumanOral
- HumanSkin
- HumanVaginal
- HydrocarbonResourcesCores
- HydrocarbonResourcesFluidsSwabs
- MicrobialMatBiofilm
- MiscellaneousNaturalOrArtificialEnvironment
- PlantAssociated
- Sediment
- Soil
- SymbiontAssociated
- WastewaterSludge
- Water
range: string
multivalued: true
additional_info:
name: additional_info
description: Information that doesn't fit anywhere else. Can also be used to propose
new entries for fields with controlled vocabulary
title: additional info
from_schema: https://w3id.org/mixs
keywords:
- information
slot_uri: MIXS:0000300
alias: additional_info
owner: MigsViHydrocarbonResourcesFluidsSwabs
domain_of:
- HydrocarbonResourcesCores
- HydrocarbonResourcesFluidsSwabs
range: string
class_uri: MIXS:0010005_0016016