Term: adapters (adapters)

Adapters provide priming sequences for both amplification and sequencing of the sample-library fragments. Both adapters should be reported; in uppercase letters

URI: MIXS:0000048

Applicable Checklists and Extensions

NOTE: does not include Combinations (of checklists and extensions) that use adapters.

Name	Description	Checklist/Extension
MigsPl	Minimal Information about a Genome Sequence: plasmid	Checklist
MigsEu	Minimal Information about a Genome Sequence: eukaryote	Checklist
MigsVi	Minimal Information about a Genome Sequence: virus	Checklist
MimarksS	Minimal Information about a Marker Sequence: survey	Checklist
Agriculture	A collection of terms appropriate when sequencing samples obtained in an agri...	Extension
MimsMisip	Metagenome or Environmental with SIP	Checklist
Miuvig	Minimum Information About an Uncultivated Virus Genome	Checklist
MigsOrg	Minimal Information about a Genome Sequence: organelle	Checklist
Mimag	Minimum Information About a Metagenome-Assembled Genome	Checklist
Misag	Minimum Information About a Single Amplified Genome	Checklist
MigsBa	Minimal Information about a Genome Sequence: cultured bacteria/archaea	Checklist
Mims	Metagenome or Environmental	Checklist

Properties

• Range: String

• Cardinality: 0..1

• Structured pattern: ^{dna_bases};{dna_bases}$

Examples

Value
AATGATACGGCGACCACCGAGATCTACACGCT;CAAGCAGAAGACGGCATACGAGAT

LinkML Source

name: adapters
description: Adapters provide priming sequences for both amplification and sequencing
  of the sample-library fragments. Both adapters should be reported; in uppercase
  letters
title: adapters
examples:
- value: AATGATACGGCGACCACCGAGATCTACACGCT;CAAGCAGAAGACGGCATACGAGAT
in_subset:
- sequencing
from_schema: https://w3id.org/mixs
slot_uri: MIXS:0000048
alias: adapters
domain_of:
- MimsMisip
- MigsBa
- MigsEu
- MigsOrg
- MigsPl
- MigsVi
- Mimag
- MimarksS
- Mims
- Misag
- Miuvig
- Agriculture
range: string
structured_pattern:
  syntax: ^{dna_bases};{dna_bases}$
  interpolated: true
  partial_match: true