Term: adapters (adapters)
Adapters provide priming sequences for both amplification and sequencing of the sample-library fragments. Both adapters should be reported; in uppercase letters
URI: MIXS:0000048
Applicable Checklists and Extensions
NOTE: does not include Combinations (of checklists and extensions) that use adapters.
Name | Description | Checklist/Extension |
---|---|---|
MigsVi | Minimal Information about a Genome Sequence: virus | Checklist |
Mimag | Minimum Information About a Metagenome-Assembled Genome | Checklist |
MigsOrg | Minimal Information about a Genome Sequence: organelle | Checklist |
Miuvig | Minimum Information About an Uncultivated Virus Genome | Checklist |
MigsPl | Minimal Information about a Genome Sequence: plasmid | Checklist |
Agriculture | A collection of terms appropriate when sequencing samples obtained in an agri... | Extension |
MigsBa | Minimal Information about a Genome Sequence: cultured bacteria/archaea | Checklist |
Misag | Minimum Information About a Single Amplified Genome | Checklist |
Mims | Metagenome or Environmental | Checklist |
MimarksS | Minimal Information about a Marker Sequence: survey | Checklist |
MigsEu | Minimal Information about a Genome Sequence: eukaryote | Checklist |
Properties
- Range: String
-
Cardinality: 0..1
-
Structured pattern:
^{adapter_A_DNA_sequence};{adapter_B_DNA_sequence}$
Examples
Value |
---|
AATGATACGGCGACCACCGAGATCTACACGCT;CAAGCAGAAGACGGCATACGAGAT |
LinkML Source
name: adapters
description: Adapters provide priming sequences for both amplification and sequencing
of the sample-library fragments. Both adapters should be reported; in uppercase
letters
title: adapters
examples:
- value: AATGATACGGCGACCACCGAGATCTACACGCT;CAAGCAGAAGACGGCATACGAGAT
in_subset:
- sequencing
from_schema: https://w3id.org/mixs
slot_uri: MIXS:0000048
alias: adapters
domain_of:
- MigsBa
- MigsEu
- MigsOrg
- MigsPl
- MigsVi
- Mimag
- MimarksS
- Mims
- Misag
- Miuvig
- Agriculture
range: string
structured_pattern:
syntax: ^{adapter_A_DNA_sequence};{adapter_B_DNA_sequence}$
interpolated: true
partial_match: true